pGART-GFP
(Plasmid #99106)

• Purpose: Expresses human GART-GFP fusion in mammalian cells
• Depositing Lab: Stephen Benkovic
• Publication: An et al Science. 2008 Apr 4;320(5872):103-6. doi: 10.1126/science.1152241.

Backbone

• Vector backbone: pCI-neo
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 5472
• Total vector size (bp): 9236
• Modifications to backbone: insertion of GFP from pLTG82 into XhoI and SalI restriction sites (SalI restriction site destroyed)
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GART
• Alt name: TrifGART
• Alt name: phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
• Species: H. sapiens (human)
• Insert Size (bp): 3030
• Mutation: A65T, L68V, and A72S mutations in GFP gene; kanR/neoR selection markers destroyed (deletion of amino acids 138-144)
• GenBank ID: NM_000819
• Entrez Gene: GART (a.k.a. AIRS, GARS, GARTF, PAIS, PGFT, PRGS)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry