-
PurposeControl gRNA under the regulation of an optimized chicken specific U6 promoter
-
Depositing Lab
-
Depositing OrganizationCalifornia Institute of Technology
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 99140-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 99140-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCESAx
- Total vector size (bp) 3017
-
Modifications to backboneBsaI sites destroyed
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameControl gRNA
-
gRNA/shRNA sequenceGCACTGCTACGATCTACACC
- Promoter Chicken U6.3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer atcggctaagcgggcctaag
- 3′ sequencing primer tggcctgcccggttattattatt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 99140-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 99140-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6.3>Control.gRNA.f+e was a gift from Marianne Bronner (Addgene plasmid # 99140 ; http://n2t.net/addgene:99140 ; RRID:Addgene_99140) -
For your References section:
Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Gandhi S, Piacentino ML, Vieceli FM, Bronner ME. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036. 10.1016/j.ydbio.2017.08.036 PubMed 29150011