Eef1a-1955/-1>nls::Cas9::nls
(Plasmid #59987)

• Purpose: Eef1a (EF1alpha) promoter driving nls::Cas9::nls
• Depositing Lab: Lionel Christiaen
• Publication: Stolfi et al Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.

Backbone

• Vector backbone: pCESAx
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: nls::Cas9::nls
• Alt name: Cas9; SpCas9, humanized
• Species: Streptococcus pyogenes
• Mutation: Reverted mutations from dCas9 to wiltdtype
• Promoter: Ciinte.Eef1a (EF1alpha) -1955/-1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: EcoR1 (not destroyed)
• 5′ sequencing primer: gttagtactggttaggcgtttg
• 3′ sequencing primer: GGATTTCCTTACGCGAAATACG

Resource Information

• Supplemental Documents:
  • Genbank file
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Modified from Qi, L. S., Larson, M. H., Gilbert, L. a, Doudna, J. a, Weissman, J. S., Arkin, A. P. and Lim, W. a (2013). Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173–83.