Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

U6.3>Control.gRNA.f+e
(Plasmid #99140)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99140 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCESAx
  • Total vector size (bp) 3017
  • Modifications to backbone
    BsaI sites destroyed
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Control gRNA
  • gRNA/shRNA sequence
    GCACTGCTACGATCTACACC
  • Promoter Chicken U6.3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer atcggctaagcgggcctaag
  • 3′ sequencing primer tggcctgcccggttattattatt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6.3>Control.gRNA.f+e was a gift from Marianne Bronner (Addgene plasmid # 99140 ; http://n2t.net/addgene:99140 ; RRID:Addgene_99140)
  • For your References section:

    Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Gandhi S, Piacentino ML, Vieceli FM, Bronner ME. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036. 10.1016/j.ydbio.2017.08.036 PubMed 29150011