Skip to main content

pAD-LyseR (in lacZ deficient strain)
(Plasmid #99245)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99245 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pPro24
  • Backbone manufacturer
    Jay Keasling lab
  • Total vector size (bp) 3790
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BL21-Gold-dLac (DE3)
  • Growth instructions
    Use 24% glycerol (w/v) in glycerol stocks to avoid cell lysis upon a freeze-thaw cycle.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    phage lambda gene R
  • Alt name
    phage lambda endolysin
  • Species
    phage lambda
  • Insert Size (bp)
    474
  • Entrez Gene
    R (a.k.a. lambdap75)
  • Promoter beta-lactamase promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCACATAGCAGAACTTTAAAAGTGCT
  • 3′ sequencing primer CCG GGA GCT GCA TGT GTC AGA GG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pAD-LyseR plasmid in BL21-Gold-dLac (DE3) strain is used for producing autolysate for in vitro transcription-translation reactions without background beta-galactosidase activity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAD-LyseR (in lacZ deficient strain) was a gift from Jeff Hasty (Addgene plasmid # 99245 ; http://n2t.net/addgene:99245 ; RRID:Addgene_99245)
  • For your References section:

    Rapid and scalable preparation of bacterial lysates for cell-free gene expression. Didovyk A, Tonooka T, Tsimring L, Hasty J. ACS Synth Biol. 2017 Aug 10. doi: 10.1021/acssynbio.7b00253. 10.1021/acssynbio.7b00253 PubMed 28795570