Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
217611 ZIF-NLS-EGFP*-HOTag6-T2A-CEL-EGFP-YAP ZIF-NLS-EGFP*-HOTag6-T2A-CEL-EGFP-YAP (Homo sapiens) Shu Jun 25, 2024
131683 pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH EGFP-KASH (Synthetic), SpCas9 sgRNA vs mouse GRID1 (Mus musculus) Richie Jun 25, 2024
131684 pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH EGFP-KASH (Synthetic), SpCas9 sgRNA vs mouse GRID1 (Mus musculus) Richie Jun 25, 2024
195018 pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs CCGTATAGGCGGCTGCCCAA (Mus musculus), EGFP-KASH (Synthetic), TTCCGTGGTGGGCAACGTAG (Mus musculus) Richie Jun 25, 2024
131682 pOTTC1553 - pAAV EF1a EGFP-KASH EGFP-KASH (Synthetic) Richie Jun 25, 2024
207815 p663-UBC-miniTurbo-V5-NRF3 miniTurbo-V5-NRF3 (Homo sapiens) Major Jun 25, 2024
213497 pCC1R pcaU, nahR, rpaR, phlF, cinR, vanR, aiiA Isalan Jun 25, 2024
216522 pYES2/NTA/Leu-LegA7ΔNAnk290 LegA7 ΔNAnk290 (Other) Isberg Jun 25, 2024
216521 pYES2/NTA/Leu-LegA7ΔNAnk264 LegA7 ΔNAnk264 (Other) Isberg Jun 25, 2024
216520 pYES2/NTA/Leu-LegA7ΔAnk290 LegA7 ΔAnk290 (Other) Isberg Jun 25, 2024
216519 pYES2/NTA/Leu-LegA7Δank LegA7 ΔAnk (Other) Isberg Jun 25, 2024
216518 pYES2/NTA/Leu-LegA7 Leg A7 (Other) Isberg Jun 25, 2024
216365 pDG04439 xhNup133-Nb2t (+2Cys) Görlich Jun 25, 2024
216376 pTP789 xY-Nb1t (+2Cys) Görlich Jun 25, 2024
216375 pMSC226 xhNup358-Nb2t (+3Cys) Görlich Jun 25, 2024
216374 pTP728 xNup358-Nb1t (+3Cys) Görlich Jun 25, 2024
216373 pDG04163 xhNup214-Nb1t (+2Cys) Görlich Jun 25, 2024
216372 pMSC235 xhNup155-Nb3i (+2Cys) Görlich Jun 25, 2024
216371 pMSC261 xhNup155-Nb3i Görlich Jun 25, 2024
216370 pMSC99 xhNup155-Nb3i Görlich Jun 25, 2024
216369 pMSC100 xhNup155-Nb2i Görlich Jun 25, 2024
216368 pMSC236 xhNup155-Nb2i (+2Cys) Görlich Jun 25, 2024
216367 pMSC263 xhNup155-Nb2i Görlich Jun 25, 2024
216366 pTP489 xNup155-Nb1t (+3Cys) Görlich Jun 25, 2024
216364 pMSC130 xhNup98-Nb3i Görlich Jun 25, 2024
216363 pMSC264 xhNup98-Nb2i Görlich Jun 25, 2024
216362 pMSC129 xhNup98-Nb2i Görlich Jun 25, 2024
216361 pTP443 xNup98-Nb1t (+1Cys) Görlich Jun 25, 2024
216360 pMSC233 xhNup93-Nb4i (+2Cys) Görlich Jun 25, 2024
216359 pMSC262 xhNup93-Nb4i Görlich Jun 25, 2024
216358 pMSC98 xhNup93-Nb4i Görlich Jun 25, 2024
216357 pMSC234 xhNup93-Nb3t (+2Cys) Görlich Jun 25, 2024
216356 pMSC115 xNup93-Nb2t Görlich Jun 25, 2024
216355 pTP416 xNup93-Nb1t (+1Cys) Görlich Jun 25, 2024
216354 pMSC96 xNup93-Nb1t Görlich Jun 25, 2024
216353 pTP487 xNup62-Nb1t (+3Cys) Görlich Jun 25, 2024
216352 pDG04477 xhNup35-Nb1t Görlich Jun 25, 2024
216351 pMSC227 xhNup35-Nb1t (+3Cys) Görlich Jun 25, 2024
216350 pMSC168 xhNup35-Nb1t (+2Cys) Görlich Jun 25, 2024
214601 AiP1977 - pAAV-AiE2586m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214599 AiP1971 - pAAV-AiE2587m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214598 AiP1970 - pAAV-AiE2585m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214597 AiP1969 - pAAV-AiE2563m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214595 AiP1965 - pAAV-AiE2475m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214594 AiP1964 - pAAV-AiE2593m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214593 AiP1963 - pAAV-AiE2592m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214592 AiP1962 - pAAV-AiE2591m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214590 AiP1959 - pAAV-AiE2588m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214589 AiP1956 - pAAV-AiE2550m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024
214587 AiP1941 - pAAV-AiE2525m-minBG-SYFP2-WPRE-BGHpA SYFP2 (Synthetic) Tasic Jun 24, 2024