-
PurposeBroad-host plasmid expressing gfp under pLtetO promoter
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89476-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89476-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepRSF
-
Backbone manufacturerSergey V Mashko
- Backbone size w/o insert (bp) 8728
- Total vector size (bp) 9664
-
Modifications to backboneinserted pLtetO-gfpmut3b
-
Selectable markersCarbenicillin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepLtetO-GFPmut3b
-
Insert Size (bp)717
- Promoter pLtetO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCATCAAATTAAGCAGAAGGCCATCCTGA
- 3′ sequencing primer GCTTCCCGTTTCAGCTGCGTTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2016/06/12/058487 for bioRxiv preprint.
DNA (Catalog # 89476-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89476-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSF-pLtetO-gfp was a gift from George Church (Addgene plasmid # 89476 ; http://n2t.net/addgene:89476 ; RRID:Addgene_89476) -
For your References section:
Functional genomics of the rapidly replicating bacterium Vibrio natriegens by CRISPRi. Lee HH, Ostrov N, Wong BG, Gold MA, Khalil AS, Church GM. Nat Microbiol. 2019 Apr 8. pii: 10.1038/s41564-019-0423-8. doi: 10.1038/s41564-019-0423-8. 10.1038/s41564-019-0423-8 PubMed 30962569