Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTRKH3-ermGFP
(Plasmid #27169)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 27169 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRKH3
  • Backbone size w/o insert (bp) 7493
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    erythromycin ribosomal methylase promoter region fused with modified green fluorescent protein 5
  • Alt name
    Enterococcus faecalis ermB promoter
  • Alt name
    synthetic construct mgfp5
  • Species
    Enterococcus faecalis and synthetic construct
  • Insert Size (bp)
    1279
  • Mutation
    presence of an additional 183-bp region at N terminal on insert

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGTGAAAAGTTCTTCTCCTT
  • 3′ sequencing primer GCGGCACGACTTCTTCAAGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRKH3-ermGFP was a gift from Michela Lizier (Addgene plasmid # 27169 ; http://n2t.net/addgene:27169 ; RRID:Addgene_27169)
  • For your References section:

    Comparison of expression vectors in Lactobacillus reuteri strains. Lizier M, Sarra PG, Cauda R, Lucchini F. FEMS Microbiol Lett. 2010 Jul 1. 308(1):8-15. 10.1111/j.1574-6968.2010.01978.x PubMed 20455948