Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #99842)


Item Catalog # Description Quantity Price (USD)
Plasmid 99842 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Michel Fons
  • Backbone size w/o insert (bp) 6332
  • Total vector size (bp) 7357
  • Modifications to backbone
    the ldhl promoter was inserted 5’ of the FLAG-mRFP1
  • Vector type
    Bacterial Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    LB medium
  • Copy number
    High Copy


  • Gene/Insert name
    monomeric red fluorescent protein
  • Alt name
  • Species
    Discosoma coral
  • Insert Size (bp)
  • GenBank ID
  • Promoter ldhl
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GCAAGGCGATTAAGTTGGGTAAC
  • 3′ sequencing primer ACGGTAAAACCATCGACCAATATCT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, et al. (2002) A monomeric red fluorescent protein. Proc Natl Acad Sci U S A 99: 7877-7882.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEM415-ldhL-mRFP1 was a gift from Sujin Bao (Addgene plasmid # 99842 ; ; RRID:Addgene_99842)
  • For your References section:

    Distribution dynamics of recombinant Lactobacillus in the gastrointestinal tract of neonatal rats. Bao S, Zhu L, Zhuang Q, Wang L, Xu PX, Itoh K, Holzman IR, Lin J. PLoS One. 2013;8(3):e60007. doi: 10.1371/journal.pone.0060007. Epub 2013 Mar 27. PONE-D-12-29032 [pii] PubMed 23544119