Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTRK892
(Plasmid #71803)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71803 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRK882
  • Backbone manufacturer
    N/A
  • Backbone size w/o insert (bp) 4568
  • Total vector size (bp) 6470
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    E. coli MC1061
  • Growth instructions
    Cloning and propagation in E. coli MC1061. Erythromycin selection is 150 ug/ml
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gusA3
  • Alt name
    mutated gusA from L. gasseri ADH
  • Species
    Lactobacillus gasseri
  • Insert Size (bp)
    1902
  • Mutation
    D573A
  • Promoter Ppgm

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTTGAAGAAGCTAAGAAGGCT
  • 3′ sequencing primer GTTATTATCAGTGTATAAGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRK892 was a gift from Rodolphe Barrangou & Todd Klaenhammer (Addgene plasmid # 71803 ; http://n2t.net/addgene:71803 ; RRID:Addgene_71803)
  • For your References section:

    Construction of vectors for inducible and constitutive gene expression in Lactobacillus. Duong T, Miller MJ, Barrangou R, Azcarate-Peril MA, Klaenhammer TR. Microb Biotechnol. 2011 May;4(3):357-67. doi: 10.1111/j.1751-7915.2010.00200.x. Epub 2010 Sep 1. 10.1111/j.1751-7915.2010.00200.x PubMed 21375708