pTRK892
(Plasmid #71803)

• Purpose: Expression of mutated L. gasseri gusA from strong Ppgm promoter
• Depositing Labs: Rodolphe Barrangou, Todd Klaenhammer
• Publication: Duong et al Microb Biotechnol. 2011 May;4(3):357-67. doi: 10.1111/j.1751-7915.2010.00200.x. Epub 2010 Sep 1.

Backbone

• Vector backbone: pTRK882
• Backbone manufacturer: N/A
• Backbone size w/o insert (bp): 4568
• Total vector size (bp): 6470
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Erythromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): E. coli MC1061
• Growth instructions: Cloning and propagation in E. coli MC1061. Erythromycin selection is 150 ug/ml
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: gusA3
• Alt name: mutated gusA from L. gasseri ADH
• Species: Lactobacillus gasseri
• Insert Size (bp): 1902
• Mutation: D573A
• Promoter: Ppgm

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: GTTGAAGAAGCTAAGAAGGCT
• 3′ sequencing primer: GTTATTATCAGTGTATAAGCT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry