We narrowed to 3,899 results for: gast
-
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pUAS-hhN-HA
Plasmid#240236PurposeExpression of hhN-HA under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorInserthedgehog N-terminal fragment (hh Fly)
TagsHA-spGFP11ExpressionInsectMutationaa 1-257PromoterUASAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG426-GAL-SoxN-A22-EGFP
Plasmid#181731PurposeGalactose inducible expression of SoxN-A22-EGFPDepositorInsertSoxN-A22-EGFP (SoxN Fly)
Tags3xFLAG-EGFPExpressionYeastMutationextended repeat of 22 Ala residues replacing nati…Available sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKC52
Plasmid#226780PurposeExpresses Drosophila UNC-104(R348G) in insect cellsDepositorInsertDrosophila unc-104 (R348G) (unc-104 Fly)
TagssfGFP and 2xStrepIIExpressionInsectMutationchanged Arginine 348 to GlycineAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKC50
Plasmid#226778PurposeExpresses Drosophila UNC-104(V6M) in insect cellsDepositorInsertDrosophila unc-104 (V6M) (unc-104 Fly)
TagssfGFP and 2xStrepIIExpressionInsectMutationchanged Valine 6 to MethionineAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSN539
Plasmid#226775PurposeExpresses Drosophila UNC-104(wild-type) in insect cellsDepositorAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKC51
Plasmid#226779PurposeExpresses Drosophila UNC-104(A255V) in insect cellsDepositorInsertDrosophila unc-104 (A255V) (unc-104 Fly)
TagssfGFP and 2xStrepIIExpressionInsectMutationchanged Alanine 255 to ValineAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-NOT1 isoform C-mCherry-PH (EB5)
Plasmid#206474PurposeNOT1 expression in Schneider cells for imagingDepositorAvailable sinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-PH-mCherry-Oskar 388-606 (OSK domain) (HK75)
Plasmid#206463PurposeOskar 388-606 expression in Schneider cells for imagingDepositorAvailable sinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-EGFP-Aubergine 4R-K (R11K/R13K/R15K/R17K) (HK121)
Plasmid#206433PurposeAubergine expression in Schneider cells for imagingDepositorAvailable sinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-mEGFP-NOT1 isoform C (HK53)
Plasmid#206440PurposeNOT1 expression in Schneider cells for imagingDepositorAvailable sinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-mEGFP-NOT2 isoform A (HK54)
Plasmid#206441PurposeNOT1 expression in Schneider cells for imagingDepositorAvailable sinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-mCherry-Bruno isoform A (JM78)
Plasmid#206446PurposeBruno expression in Schneider cells for imagingDepositorAvailable sinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-PH-mEGFP-Bruno isoform A (JM165)
Plasmid#206452PurposeBruno expression in Schneider cells for imagingDepositorAvailable sinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-PH-mCherry-Oskar 139-606 isoform A (Short Oskar) (HK195)
Plasmid#206460PurposeOskar 139-606 expression in Schneider cells for imagingDepositorAvailable sinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
Plasmid#217509PurposeKD Recombinase dependent conditional 1X ALFA cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
TagsALFA tagExpressionInsectAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
Hy_U5:34A eGFP SV40
Plasmid#195064PurposeExpresses eGFP when there is readthrough transcription from the Drosophila U5:34A geneDepositorAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUAS-kkv-OH
Plasmid#138956PurposeUsed to generate a transgene that will express an epitope tagged Chitin Synthase in Drosophila using Gal4DepositorPublicationInsertkkv with C terminal epitope tag (kkv Fly)
Tagsollas and his-6 added to C terminus of protein co…ExpressionInsectPromoterUASAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHD-DsRed-kkv-3::NG
Plasmid#138960PurposeUsed to edit the endogenous Drosophila kkv gene to encode a fluorescent Chitin Synthase.DepositorPublicationInsert3' end of kkv and neon green (kkv Fly)
UseAn editing vector for drosophilaTagsNeon Green fused to C terminus of KkvAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV1-DIO-eGFP-pvRPL10a
Plasmid#202542PurposeCr-dependent (DIO) expression of eGFP-tagged ribosomal subunit that uses the prairie vole RPL10a gene sequence under the human synapsin promoter.DepositorInsertRPL10a subunit of the ribosome
UseAAV and Cre/LoxTagseGFPExpressionMammalianMutationoptimized for prairie vole DNA sequence and optim…Promoterhuman synapsinAvailable sinceAug. 23, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by