We narrowed to 19 results for: gast
-
TypeBlog Post...fly (Drosophila melanogaster) Another popular model organism is Drosophila melanogaster, or as it is more...Nichols. "Human disease models in Drosophila melanogaster and the role of the fly in therapeutic drug ...
-
Six Spooky Science Stories and Halloween at Addgene
TypeBlog Post...cytochrome P450 genes discovered in Drosophila melanogaster (Gilbert, 2004). Mutations in these genes are...mediate steroid hormone biosynthesis in Drosophila melanogaster." Molecular and cellular endocrinology 215.1... -
Using Ultrasound to Image Bacteria in vivo: Acoustic Reporter Genes
TypeBlog Post... organs located deep in the body, like the gastrointestinal tract. Require Administration of Substrate...coli aided in ultrasound imaging of the mouse gastrointestinal tract. The E. coli strain Nissle 197 (ECN)... -
What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program
TypeBlog Post...using them grow. So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research...This is actually rare in the animal kingdom. Gasterosteus aculeates (Dan Bolnick) A paper on stickleback... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...Flybow adapts Brainbow 2.0 for use in Drosophila melanogaster and is under the control of Flp recombinase....labeling for neural circuit analysis in Drosophila melanogaster." Nature methods 8.3 (2011): 260. PubMed PMID... -
Exploring Applications of the Bioluminescent HiBiT Tag
TypeBlog Post...first identified that in a set of patients with gastric cancer (GC), TP53 was one of the most frequently...Site-Linked Chemosensitivity in Early- and Late-Onset Gastric Cancer. Cancer Medicine, 14(8). https://doi.org... -
CUT&RUN: An Improved Method for Studying Protein-DNA Interactions
TypeBlog Post...organs in whole animal models like Drosophila melanogaster, obtaining enough material for a ChIP-seq experiment... -
Hot Plasmids - October 2020
TypeBlog Post...targeting Cas system that can be used in Drosophila melanogaster. Get the plasmids at Addgene The Cas Hybrid... -
Quickest Way to Deposit Plasmids: The Deposit Spreadsheet
TypeBlog Post..., X. laevis (frog), D. rerio (zebrafish), D. melanogaster (fly), C. elegans (nematode), S. cerevisiae ... -
Fluorescent Tagging of Endogenous Genes with SapTrap
TypeBlog Post...Toolbox for Genome Editing in Cultured Drosophila melanogaster Cells.” G3 (Bethesda) 6(6) (2016):1777-85. PubMed... -
Transgenic Organisms, Cas9 Gene Drives, and Appropriate Safeguards
TypeBlog Post...Replacement by Compound Autosomes in Drosophila melanogaster. Genetics 74, 461–475 (1973). PubMed. More ... -
Using Video to Share Your Science: We Share Science
TypeBlog Post...Journal of Number Theory (1,519 views), and Gastroenterology (1,046 views) rounded out the top four average... -
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post...labeling for neural circuit analysis in Drosophila melanogaster. Hadjieconomou D, Rotkopf S, Alexandre C, Bell... -
Custom CRISPR Screens & the Green Listed Software
TypeBlog Post...academic labs, targeting mouse, human, Drosophila melanogaster, and T. gondii are available through www.addgene.org... -
Immunology Research Plasmids and Resources
TypeCollection...MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1, GLP2, GRPP GCGR glucagon...secretagogue receptor - GIP gastric inhibitory polypeptide - GIPR gastric inhibitory polypeptide receptor...HSCR, HSCR2 EGF epidermal growth factor (beta-urogastrone) HOMG4, URG EGFR epidermal growth factor receptor...receptor MGC126722 GKN1 gastrokine 1 AMP18, BRICD1, CA11, FOV, MGC70354, foveolin GLP1R glucagon-like peptide... GRN granulin GEP, GP88, PCDGF, PEPI, PGRN GRP gastrin-releasing peptide BN, GRP-10, preproGRP, proGRP... -
Ras Pathway
TypeCollection...colorectal cancer. Zenonos K, Kyprianou K. World J Gastrointest Oncol. 2013 May 15; 5(5): 97–101. doi: 10.4251... -
TALEN Plasmids and Kits
TypeCollection...germline mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 - 49647 24 plasmids... -
CRISPR Pooled gRNA Libraries
TypeCollection...Neelamegham 3rd 10 3,637 Oxford Fly 64750 Knockout D. melanogaster Liu N/A 3 40,279 Pan-Druggable Cancer Library... -
Validated gRNA Sequences
TypeCollection...61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186...