Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 6 of 6 results
  1. CRISPR Fly Design - Drosophila genome engineering

    Type
    Collection
    ... ubiquitous genome engineering in Drosophila melanogaster. Bullock 62208 pnos-Cas9-nos Expresses Cas9 ... restricted genome engineering in Drosophila melanogaster. Bullock 62211 pAct-Fok1:dCas9 Expresses Fok1...specificity genome engineering in Drosophila melanogaster. Bullock 62210 pnos-Fok1:dCas9-nos Expresses...specificity genome engineering in Drosophila melanogaster. Bullock...
  2. Immunology Research Plasmids and Resources

    Type
    Collection
    ...MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1, GLP2, GRPP GCGR glucagon...secretagogue receptor - GIP gastric inhibitory polypeptide - GIPR gastric inhibitory polypeptide receptor...HSCR, HSCR2 EGF epidermal growth factor (beta-urogastrone) HOMG4, URG EGFR epidermal growth factor receptor...receptor MGC126722 GKN1 gastrokine 1 AMP18, BRICD1, CA11, FOV, MGC70354, foveolin GLP1R glucagon-like peptide... GRN granulin GEP, GP88, PCDGF, PEPI, PGRN GRP gastrin-releasing peptide BN, GRP-10, preproGRP, proGRP...
  3. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Neelamegham 3rd 10 3,637 Oxford Fly 64750 Knockout D. melanogaster Liu N/A 3 40,279 Pan-Druggable Cancer Library...
  4. Ras Pathway

    Type
    Collection
    ...colorectal cancer. Zenonos K, Kyprianou K. World J Gastrointest Oncol. 2013 May 15; 5(5): 97–101. doi: 10.4251...
  5. TALEN Plasmids and Kits

    Type
    Collection
    ...germline mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 - 49647 24 plasmids...
  6. Validated gRNA Sequences

    Type
    Collection
    ...61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186...
Showing: 1 - 6 of 6 results