We narrowed to 4,668 results for: IRES
-
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pStr-KDEL_EPV-CXCL9-mCherry-SBP
Plasmid#170678PurposeExpresses ER-targeted streptavidin-KDEL (hook) and CXCL9-mCherry-SBP targeted to the ER lumen with an N-terminal EPV tripeptide (cargo) for RUSH.DepositorInsertsTagsSBP and mCherryExpressionMammalianMutationChanged threonine 23 to glutamate (T23E)PromoterIRES and T7Available SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCT-CMV-copGFP-Polß(L301R/V303R/V306R)-puro
Plasmid#128666Purposemammalian expression of copGFP-Polß(L301R/V303R/V306R: TM) protein with puromcyin selectionDepositorInsertPolB (POLB Human)
UseLentiviralTagscopGFPExpressionMammalianMutationL301R/V303R/V306RPromoterCMVAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
CSII-IDR2-owlTRIMCyp-FOS K283D Q287D
Plasmid#79068PurposeExpress owl monkey TRIMCyp K283D, Q287D in mammalan cellsDepositorInsertTRIM5Cyp (owl monkey) (K283D, Q287D)-FOS
TagsOneSTrEP-FLAGExpressionMammalianMutationChanged Lys 283 to Asp and Gln 287 to AspPromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV40-EF1a-hBCL10(1-114)-SO
Plasmid#75257Purposeretroviral expression vector for expression of StrepOne-Tagged human BCL10 (AS 1-116)DepositorInsertBcl10 (BCL10 Human)
UseRetroviralTagsStrepOne TagExpressionMammalianMutationAS 1-116 (CARD-domain)PromoterpMSCV-LTRs, EF1aAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPP7CP-myc-T2A-tagRFP
Plasmid#140262PurposeExpresses PP7CP in mammalian cellsDepositorInsertCoat protein of bacteriphage PP7
UseSynthetic BiologyTagsmyc-T2A-tagRFPExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A mKate2-hu_ncOGT K842M
Plasmid#154284PurposeEntry vector encoding mKate2-2xFLAG-OGT (O-GlcNAc Transferase; K842M variant, catalytic dead)DepositorInsertO-GlcNAc Transferase (OGT Human)
UseGateway CloningTags2x FLAG and mKate2MutationK842M mutation (Catalytic Inactive)Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-skywarp-CRISPR-resistant
Plasmid#134252PurposeLentivector encoding CRISPR-resistant skywarp form of Snrnp40 (missing exon 5)DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationdeleted amino acids 179-219, and mutated coding s…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-N3FLAG-TAF12
Plasmid#105593Purposeretrovirally express mouse TAF12 with 3*FLAG tag at N terminal, GFP marker and puro resistanceDepositorInsertfull length TAF12 with silent mutations, making it resistant to TAF12 shRNA#364 (Taf12 Mouse)
UseRetroviralTags3*FLAGExpressionMammalianMutationsilent mutations to make it resistant to the targ…PromoterMSCV-LTRAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL-SBP-EGFP-LAMP1
Plasmid#222317PurposeSynchronize the trafficking of LAMP1 from the ER.DepositorInsertStreptavidin-KDEL and LAMP1 fused to SBP-EGFP (LAMP1 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD63-SBP-mCherry
Plasmid#222326PurposeSynchronize the trafficking of CD63 from the ER.DepositorInsertStreptavidin-KDEL and CD63 fused to SBP-mCherry (CD63 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-N3FLAG-TAF12(50-130)
Plasmid#105595Purposeretrovirally express mouse TAF12 HFD with 3*FLAG tag at N terminal, GFP marker and puro resistanceDepositorInsertTAF12 (AA 50-130)- histone fold domain-HFD (Taf12 Mouse)
UseRetroviralTags3*FLAGExpressionMammalianMutationtruncation fragments containing aa (50-130), and …PromoterMSCV-LTRAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 R9H res
Plasmid#214753Purposeexpresses human MR1 R9H resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-CFP-e2a-SOX2-p2a-KLF4
Plasmid#193358PurposeVEE-CFP-SK (self-replicating RNA vector expressing CFP + human SOX2 + KLF4 + PuroR)DepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianPromoterT7Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(1-686)AVITEV
Plasmid#74054Purposeretroviral expression plasmid for human NFATc2/C (without C-terminal region) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human, AS 1-686 (N terminus deleted))
UseRetroviralTagsAVI-TEVExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…PromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(1-686, RIT)FLAG-AVITEV
Plasmid#74055Purposeretroviral expression plasmid for human NFATc2/C(1-686, RIT) (without C-terminal region, with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 Human, AS 1-686 (N terminus deleted))
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…Available SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLLNeo
Plasmid#21617DepositorTypeEmpty backboneUseLentiviral and RNAiAvailable SinceAug. 25, 2009AvailabilityAcademic Institutions and Nonprofits only -
pJH4531
Plasmid#132366PurposePrgef-1 DAF-2 unc-54 3' UTR C.elegans pan-neural expression of DAF-2. This plasmid has replaced plasmid pJH664 from the Zhen Lab.DepositorAvailable SinceSept. 22, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET21-pelB-LaM-8
Plasmid#172772PurposeBacterial expression of anti-mCherry nanobody LaM-8, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-8
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only