We narrowed to 6,509 results for: nls
-
Plasmid#126774PurposeExpression of increased fidelity eSpCas9-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorInserteSpCas9-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP310-pAAV-Mecp2P-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113687PurposeSaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX398 Nitratifractor salsuginis str DSM 16511 Cas9
Plasmid#68334PurposeNitratifractor salsuginis str DSM 16511 Cas9DepositorInsertNsCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
enIscB-T5E
Plasmid#205411PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fused with T5E at C-terminal driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_XTEN_T5E_npNLS_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP790_αGCN4-EZH2-FL-CO
Plasmid#211784PurposeSunTag counterpart binding domain, aGCN4, fused to polycomb repressive complex subunit EZH2, with GFP selectionDepositorInsertSnoopCatcher-KRAB
Tags2xOLLASExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP778_Traptavidin-p65HSF1-CO
Plasmid#211771PurposeAviTag counterpart binding domain, Traptavidin, fused to transcriptional activator p65HSF1, with sfGFP selectionDepositorInsertTraptavidin-p65HSF1
Tags3xV5ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect p65HSF…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP776_SpyCatcher-p65HSF1-CO
Plasmid#211769PurposeSpyTag counterpart binding domain, SpyCatcher, fused to transcriptional activator p65HSF1, with GFP selectionDepositorInsertSpyCatcher-p65HSF1
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect p65HSF…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-Hyg-CTCF-Nterm-N1
Plasmid#131800PurposeExpresses the [N-terminus of human CTCF (a.a. 2-265)]-GFP in mammalian cellsDepositorInsertCTCF (CTCF Human)
TagsGFPExpressionMammalianMutationdeleted amino acids 796-2181 (the N-terminus is l…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
(517) SB KRAB-SadCas9 U6-gStop
Plasmid#163023PurposeSleeping Beauty TET-On expression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseTransposonTagsKRAB and myc NLSExpressionMammalianPromoterTet-OnAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pvPE-V3
Plasmid#240287PurposeEncodes third generation porcine endogenous retrovirus-derived prime editing (pvPE) system into mammalian cells for gene editing.DepositorInsertpvPE-V3
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGK)
Plasmid#172328PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato 2a HSVtk 2a Neo followed by an PGK promoter driving nuclear d2eGFP E2A HygromycinDepositorInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterPGKAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNS35 (multiAsCas12a piggyBac)
Plasmid#217336PurposepiggyBac expression of multiAsCas12aDepositorInsertmultiAsCas12a
UseCRISPRTags6xMycNLS and HA-SV40NLS-P2A-TagBFP2ExpressionMammalianMutationR1226A/E174R/S542R/K548RPromoterCAGAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJC2528 - CLYBL-Neo-CAGGS-LSL-dCas9-TagBFP-KRAB-CLYBL (LSL-CRISPRi)
Plasmid#250253PurposeHomology donor for knock-in of CRISPRi system into CLYBL locus with addgene plasmids 62196 and 62197. Lox-Stop-Lox requires cre delivery for activation.DepositorInsertdCas9-mTagBFP-KRAB
UseCRISPRTagsHA-2xSV40 NLS-mTagBFP-KRABExpressionMammalianPromoterCAGGSAvailable SinceJan. 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-aaAFB2
Plasmid#207839PurposeInducible AFB2 Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsatAFB2
mCherry
miniIAA7
VHH-GFP4
Tags3X FLAG-Tag and weak NLSExpressionMammalianMutationAll K mutated to RPromoterTRE3G BI promoterAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG
Plasmid#179081PurposeNOTE: An improved version of this plasmid is now available. See Addgene plasmid #242072. All-in-one prime editor piggyBac transposon, SpG variantDepositorInsertSpCas9 SpG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135L, S1136W, G1218K, E1219Q, R1335Q, T1337RPromoterCAGAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PE xCas9
Plasmid#172652PurposeAll-in-one prime editor piggyBac transposon (xCas9)DepositorInsertxCas9_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationA262T, R324L, S409I, E480K, E543D, M694I, E1219VAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTE3334
Plasmid#107537PurposeExpresses Mb crRNA and human codon optimized MbCpf1(RVR mutant) in mammalian cells.DepositorInsertsMb crRNA
hMbCpf1(RVR mutant)
Tags3xHA and NLSExpressionMammalianMutationN576R, K582V, N586RPromoterCMV and human U6Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3330
Plasmid#107534PurposeExpresses Lb crRNA and human codon optimized LbCpf1(RVR mutant) in mammalian cells.DepositorInsertsLb crRNA
hLbCpf1(RVR mutant)
Tags3xHA and NLSExpressionMammalianMutationG532R, K538V, Y542RPromoterCMV and human U6Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
CD8a-hnRNP-M-EGFP
Plasmid#86054PurposeA mammalian expression plasmid encoding CD8a luminal and transmembrane domains followed by hnRNP-M (PY nuclear localization signal of hnRNP-M) and C-terminus EGFP.DepositorInsertCD8a (CD8A Human)
TagsGFPExpressionMammalianMutationCD8a luminal and transmembrane domians along with…PromoterCMVAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only