We narrowed to 573 results for: PA-GFP
-
Plasmid#185314PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS1_PARRC_101-189_mCh-2xFKBP (pBS1136)
Plasmid#185320PurposeFor the mammalian expression of the tardigrade protein CAHS1_PARRC_101-189 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertCAHS1_PARRC_101-189
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-2xFKBP (pBS1123)
Plasmid#185318PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_mutant_3
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k5_1_mCh-2xFKBP (pBS1122)
Plasmid#185317PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertPvLEA4_repeats_k5_1
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_10_mCh-2xFKBP (pBS1121)
Plasmid#185316PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_mutant_10
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS2_PARRC_98-130_mCh-2xFKBP (pBS1120)
Plasmid#185315PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC_98-130 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertCAHS2_PARRC_98-130
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-2xFKBP (pBS1118)
Plasmid#185313PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k3_26 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertPvLEA4_repeats_k3_26
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-2xFKBP (pBS1117)
Plasmid#185312PurposeFor the mammalian expression of the riverbank grape plant protein DHN_VrDHN1a attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertDHN_VrDHN1a
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DSUP_RAMVA_1-208_mCh-2xFKBP (pBS1116)
Plasmid#185311PurposeFor the mammalian expression of the tardigrade protein DSUP_RAMVA_1-208 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertDSUP_RAMVA_1-208
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_47-300_mCh-2xFKBP (pBS1114)
Plasmid#185309PurposeFor the mammalian expression of the human protein ApoE3_D125I_47-300 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertApoE3_D125I_47-300
ExpressionMammalianMutationD125IAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_47-300_mCh-2xFKBP (pBS1113)
Plasmid#185308PurposeFor the mammalian expression of the human protein ApoE3_47-300 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertApoE3_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_47-300_mCh-2xFKBP (pBS1112)
Plasmid#185307PurposeFor the mammalian expression of the human protein ApoE4_47-300 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertApoE4_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_47-300_mCh-2xFKBP (pBS1111)
Plasmid#185306PurposeFor the mammalian expression of the human protein ApoE2_47-300 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertApoE2_47-300
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN
Plasmid#47353PurposeClock fragment cloned and tagged with VenNDepositorAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC
Plasmid#47364PurposeBmal fragment cloned with Venus tag and used for BiFCDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC I317D
Plasmid#47367PurposeBmal fragment cloned with Venus tag used for mutationDepositorInsertBMAL (Bmal1 Mouse)
TagsVenus aa 156-239ExpressionMammalianMutationaa 1-465, I317DPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L74E
Plasmid#47355PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L74EPromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L113E
Plasmid#47356PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L113EPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only