We narrowed to 16,105 results for: grna
-
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Gattinara in pRDA_118 backbone
Pooled library#136986PurposeDesigned for assays with limited cell numbers with 2 guides per gene. Compatible with John Doench’s Brunello human genome-wide library.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSB-BbsI-sgRNA
Plasmid#203359PurposeContains BbsI cut sites for placement of user-specified sgRNA target sequences with Sleeping Beauty backboneDepositorInsertBbsI Cut Sites
Available sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP shRNA tet pLKO puro
Plasmid#163017PurposeControl tet-inducible shRNA targeting eGFPDepositorInsertEnhanced Green Fluorescent Protein
UseLentiviralAvailable sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-LoxP
Plasmid#127098PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system.DepositorInsertCas9-2A-eGFP
UseLentiviralPromoterU6Available sinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMCB306
Plasmid#89360PurposesgRNA expression vector with GFP, puromycin resistance, BlpI+BstXI cloning sitesDepositorInsertGFP, puromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiX2-PURO-shLKB1-Hu
Plasmid#61242PurposeLentivirus expressing shRNA to human LKB1DepositorInsertLKB1 (STK11 Human)
UseLentiviralAvailable sinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLV.MRE11i
Plasmid#15565DepositorPublicationAvailable sinceSept. 10, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MDH1-miR-142-PGK-GFP
Plasmid#11377DepositorPublicationInsertmiR-142
UseRNAi and RetroviralExpressionMammalianAvailable sinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSicoR Dnmt1
Plasmid#12166PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF Dnmt1 shRNA expression.DepositorInsertDnmt1 shRNA (Dnmt1 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available sinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hCRISPRi-v2, Cancer and Apoptosis (h2), top 5 sgRNAs/gene
Pooled library#83972PurposeHuman CRISPRi Pooled Library targeting cancer and apoptosis genesDepositorAvailable sinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px330-RPL26 sgRNA2
Plasmid#134642Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
ExpressionMammalianAvailable sinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-RPL26 sgRNA1
Plasmid#134641Purposecontains sgRNA targeting to the C-terminus of human RPL26 for gene editingDepositorInsertRPL26 sgRNA2 (RPL26 Human)
ExpressionMammalianAvailable sinceDec. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDR274-gsc2-sgRNA
Plasmid#184818PurposeUsed to synthesize gRNA targeting exon 2 of the gsc2 geneDepositorInsertgsc2-sgRNA
UseCRISPR; Template for sgrna synthesisAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
8xCTS1_WT-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_WT-hutRNApro_SV40polyA
Plasmid#124541PurposeCloning vector for tRNA-released synergistic activation mediator gRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertWT-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_WT-hutRNApro
ExpressionMammalianMutationWT, WTPromoterMinimal ADEAvailable sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only