We narrowed to 20,033 results for: Nov
-
Plasmid#186552PurposeNegative Control confirming the need for a CPP peptide in mediating internalizationDepositorInsert6H-ETA-GFP
Tags6xHis and EGFPExpressionBacterialPromoterT7Available sinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pet15b-Internalization and Endosomal Escape
Plasmid#186551PurposeInternalization and Endosomal Escape to effectively route a protein cargo to the cytosol of cellsDepositorInsert10R-8His-ETA-EGFP
Tags8xHis and EGFPExpressionBacterialPromoterT7Available sinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Arkadia-gRNA1
Plasmid#180374Purposetargeting mouse Arkadia geneDepositorAvailable sinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA2
Plasmid#180369Purposetargeting mouse Ski geneDepositorAvailable sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJH2037
Plasmid#179220PurposePsra-11::UNC-7-UrSL-wCherry unc-54 3' UTR C.elegans neural expression of UNC-7-wCherryDepositorAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL1180-HR-PUbEGFP-NLS
Plasmid#176681PurposeExpression of nuclear localized EGFP under Ae. aegypti Polyubiquitin promoter (AAEL003888), EGFP version of pSL1180-HR-PUbECFP (Addgene #47917)DepositorInsertEGFP
ExpressionInsectPromoterAe. aegypti poly-ubiquitin (AAEL003888)Available sinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/SPTBN1-FLT3
Plasmid#168115PurposeMammalian expression vector for the SPTBN1-FLT3 fusion gene identified in atypical chronic myeloid leukemiaDepositorInsertSPTBN1-FLT3
ExpressionMammalianAvailable sinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19 ACMV DNA-B 1.5mer
Plasmid#159135PurposeInfectious clone containing a partial-tandem-dimer of African cassava mosaic virus CM:2:98 DNA-BDepositorInsertACMV DNA-B 1.5mer
UseInfectious clone for bombarding plantsAvailable sinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pICH67131
Plasmid#153223PurposeLevel 1 position 1 containing the Nos promoter, NPTII (Kan resistance), and the Nos terminatorDepositorInsertNos promoter, NPTII, Nos terminator
UseSynthetic BiologyAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ211_rha_WT_low
Plasmid#128851PurposeLow copy number plasmid for expression of E. coli flagellin from a rhamnose-inducible promoterDepositorInsertFlagellin
ExpressionBacterialAvailable sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ291_WT_med
Plasmid#128856PurposeMedium copy number plasmid for expression of E. coli flagellin from an IPTG-inducible T5 promoterDepositorInsertFlagellin
ExpressionBacterialAvailable sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTol2-PcyA-IRES-HO1
Plasmid#131787PurposeTol2 bicistronic vector expressing PcyA and HO1 for Phycocyanobilin (PCB) synthesis, driven by heatshock promoter hsp70.DepositorInsertPcyA and HO1
UseSynthetic Biology; Zebrafish tol2 transposonTagsMTS (Mitochondrial Targeting Signal from subunit …ExpressionMammalianPromoterhsp70Available sinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pME-foxc1a
Plasmid#132971Purposefull-length of foxc1a without stop codon in pmE Gateway vectorDepositorInsertfoxc1a (foxc1a Zebrafish)
UseGateway vectorAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK226
Plasmid#129268Purposedual yTRAP, RNQ1 fusion to aTF2 reporting on [RNQ+] state with mNeonGreen reporterDepositorInsertRnq1
ExpressionYeastAvailable sinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGC
Plasmid#112812PurposePCR template vector for amplifying gRNA(F+E)-OstRNA fragmentDepositorInsertgRNAcore(F+E)-tRNA
ExpressionBacterialAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLN481 (FuGW-G8p-IL12-1Pe)
Plasmid#105191PurposeModule 3 - GAL4 synthetic promoter (with eight binding sites) drives the expression of IL12 transcripts containing miR1-Bs(Pe)DepositorInsertG8p-IL12-1Pe
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable sinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21a - Mtb-TF
Plasmid#111513PurposeExpresses M. tuberculosis Trigger Factor with a C-terminal His tagDepositorInsertTrigger Factor
TagsHis tagExpressionBacterialPromoterT7Available sinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ140
Plasmid#99895PurposeEmpty vector with attL5-attL2 recombination sites for Gateway CloningDepositorTypeEmpty backboneUseCRISPR and TALENAvailable sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBS-AC3CtermGenomic-mCherry
Plasmid#105250Purposemouse mCherry (with STOP and extra-sequence) with homology arms for Adcy3DepositorInsertmCherry (with STOP and extra-sequence) with homology arms for mouse Adcy3 (Adcy3 Mouse)
ExpressionBacterialAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only