pH307HP
(Plasmid
#27385)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27385 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19 modified
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepost- ligation product of ligase ribozyme
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pH307HP is used to transcribe RNA representing the post-
ligation product of the ribozyme. To ensure a homogenous 5´ terminus with the 5´- hydroxyl resembling that of the synthetic substrate, the transcript began with a hammerhead (HH) self-cleaving ribozyme, which excises itself from the ribozyme. The relevant sequence of the insert is
GCGTAATACGACTCACTATAGGGAGATTCCTACTGGACTGATGAGTCCGTGAGGACGAA
ACGGTACCCGGTACCGTCTCCAGTAGGAACACTATACTACTGGATAATCAAAGACAAAT
CTGCCCGAAGGGCTTGAGAACATACCCATTGCACTCCGGGTATGCAGAGGTGGCAGCCT
CCGGTGGGTTAAAACCCAACGTTCTCAACAATAGTGAGGCCGGCATGGTCCCAGCCTCC
TCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGG
GACCCAC
See supplemental data of article for annotation of the sequence. Prior to use as template for in vitro transcription, plasmid was
digested with EarI nuclease.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pH307HP was a gift from David Bartel (Addgene plasmid # 27385 ; http://n2t.net/addgene:27385 ; RRID:Addgene_27385) -
For your References section:
Crystal structure of the catalytic core of an RNA-polymerase ribozyme. Shechner DM, Grant RA, Bagby SC, Koldobskaya Y, Piccirilli JA, Bartel DP. Science. 2009 Nov 27. 326(5957):1271-5. 10.1126/science.1174676 PubMed 19965478