We narrowed to 8,278 results for: 11
-
Plasmid#196022PurposeExpresses CRKL Y207F + W275LDepositorInsertCRKL
UseRetroviralAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWzl_CRKL-W275L
Plasmid#196019PurposeExpresses CRKL W275LDepositorInsertCRKL
UseRetroviralAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3_CRKL-Y207F-V5
Plasmid#196016PurposeExpresses CRKL Y207F, V5 taggedDepositorInsertCRKL
UseLentiviralExpressionMammalianAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv2.1 K+ channel [D4/11R]
Plasmid#188179PurposeMammalian Expression Plasmid of anti-Kv2.1 K+ channel (Rat). Derived from hybridoma D4/11DepositorInsertanti-Kv2.1 K+ channel (Rattus norvegicus) recombinant mouse monoclonal antibody (Kcnb1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hRSK3(RPS6KA2)
Plasmid#180384Purposelentiviral transduction of human RSK3 (RPS6KA2) geneDepositorAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv2.1 K+ channel [L83/11R]
Plasmid#177490PurposeMammalian Expression Plasmid of anti-Kv2.1 K+ channel (Rat). Derived from hybridoma L83/11.DepositorInsertanti-Kv2.1 K+ channel (Rattus norvegicus) recombinant mouse monoclonal antibody (Kcnb1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSAM2_mCherry_Mesp2
Plasmid#72693PurposeDoxycyline regulated expression of Mesp2 in mammalian cellsDepositorAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pE-SUMO_PspCas13b
Plasmid#252295PurposeExpresses PspCas13b (WT) in bacterial cells.DepositorInsertPspCas13b (WT)
ExpressionBacterialMutationWTAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSTTa
Plasmid#248647PurposeE. coli protein expression vector encoding 2x N-terminal StrepII tags flanking an 11 residue flexible linker, thrombin and TEV protease sites, and an optional C-terminal FLAG tag.DepositorTypeEmpty backboneTags2x StrepII, Thrombin site, TEV site and FLAGExpressionBacterialAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
His-13bCTS-GFP
Plasmid#247243PurposeA bacterial expression plasmid encoding ciliary targeting sequence of mammalian Arl13b (amino acids 347-363) with N-terminal His and GFP-taggedDepositorInsertArl13B (ARL13B Human)
Tags6xHis and EGFPExpressionBacterialMutationdeleted amino acid 1-346,364-428PromoterT7 PromoterAvailable SinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
CD8a-AA347-363-GFP
Plasmid#221596PurposeExpresses CD8a with ciliary targeting sequence (CTS) from amino acids 347-363 of Arl13b fused to the cytosolic tail and GFP-taggedDepositorInsertArl13b (ARL13B Human)
TagsEGFPExpressionMammalianMutationDeleted amino acid 1-346, 364-428PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CD8a-AA347-363- RVEP-4A-GFP
Plasmid#221597PurposeExpresses CD8a with of Arl13b ciliary targeting sequence (CTS) from amino acids 347-363 with RVEP4A mutation fused to the cytosolic tail and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationAmino acids 347-363 are inserted with mutation of…PromoterCMV promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAL-AA347-363-RVEP-4A-GFP
Plasmid#221593PurposeExpresses the palmitoylation sequence, the ciliary targeting sequence with RVEP4A mutation of mammalian Arl13b (amino acids 347-363) and GFP-taggedDepositorInsertArl13B (ARL13B Human)
TagsEGFPExpressionMammalianMutationdeleted amino acid 10-346 and 364-428, changed RV…PromoterCMV promoterAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN103
Plasmid#233860PurposeMoClo-YTK; ConLS/R1 cassette; NS3 systems; pTDH3-LexA-NES-NS3-V1-NLS-VP48-2XOaf1-tADH1DepositorInsertpTDH3-LexA-NES-NS3-V1-NLS-VP48-2XOaf1-tADH1
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN104
Plasmid#233861PurposeMoClo-YTK; ConLS/R1 cassette; NS3 systems; pTDH3-LexA-NES-NS3-V2-NLS-VP48-2XOaf1-tADH1DepositorInsertpTDH3-LexA-NES-NS3-V2-NLS-VP48-2XOaf1-tADH1
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUGW hUbC-Sga-dCas9-KRAB-T2A-GFP
Plasmid#227009PurposeLentiviral Expression of dCas9-KRAB from S. gallolyticus fused to the repressive KRAB domainDepositorInsertdCas9
UseCRISPR and LentiviralTags3xFLAG, SV40 NLSPromoterUbCAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUGW hUbC-Sin-dCas9-KRAB-T2A-GFP
Plasmid#227010PurposeLentiviral Expression of dCas9-KRAB from S. iniae fused to the repressive KRAB domainDepositorInsertdCas9
UseCRISPR and LentiviralTags3xFLAG, SV40 NLSPromoterUbCAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUGW hUbC-Spa-dCas9-KRAB-T2A-GFP
Plasmid#227011PurposeLentiviral Expression of dCas9-KRAB from S. parasanguinis fused to the repressive KRAB domainDepositorInsertdCas9
UseCRISPR and LentiviralTags3xFLAG, SV40 NLSPromoterUbCAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUGW hUbC-Sub-dCas9-KRAB-T2A-GFP
Plasmid#227012PurposeLentiviral Expression of dCas9-KRAB from S. uberis fused to the repressive KRAB domainDepositorInsertdCas9
UseCRISPR and LentiviralTags3xFLAG, SV40 NLSPromoterUbCAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only