We narrowed to 24,475 results for: crispr
-
Plasmid#170302PurposeA knock-out vector for the mouse GnaqDepositorInsertA gRNA targeting the mouse Gnaq gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Tbxa2r
Plasmid#170304PurposeA knock-out vector for the mouse Tbxa2rDepositorInsertA gRNA targeting the mouse Tbxa2r gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Tbxas1
Plasmid#170305PurposeA knock-out vector for the mouse Tbxas1DepositorInsertA gRNA targeting the mouse Tbxas1 gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptger1
Plasmid#170306PurposeA knock-out vector for the mouse Ptger1DepositorInsertA gRNA targeting the mouse Ptger1 gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75233PurposeCRISPR/Cas9 plasmid against human NFATc2DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7_Dual_sgRNA
Plasmid#173206PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G7 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
hETFDH CRISPR_1
Plasmid#232309PurposeHuman ETFDH Gene Knockout (gRNA 1)DepositorInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEtfdh CRISPR_2
Plasmid#232313PurposeMouse Etfdh Gene Knockout (gRNA 2)DepositorInsertEtfdh-targeting gRNA (Etfdh Mouse)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEtfdh CRISPR_1
Plasmid#232312PurposeMouse Etfdh Gene Knockout (gRNA 1)DepositorInsertEtfdh-targeting gRNA (Etfdh Mouse)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
hETFDH CRISPR_2
Plasmid#232310PurposeHuman ETFDH Gene Knockout (gRNA 2)DepositorInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CRISPR-V2-gYap-2
Plasmid#166482PurposeExpresses spCas9 and a gRNA targeting mouse YapDepositorInsertgRNA for mouse Yap (Yap1 Mouse)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-ICAM-5-Puro
Plasmid#239949PurposeCRISPR KO of human ICAM-5DepositorInsertICAM-5
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-MFSD6-Puro
Plasmid#239950PurposeCRISPR KO of human MFSD6DepositorInsertMFSD6
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR/eCas9-GPIBY55
Plasmid#213709PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of eCas9 and the affinity sorting tag TST-EGFP-GPIBY55 under separate promoters.DepositorInsertEGFP
UseCRISPRTags3XFLAG and Twin-strep-tagExpressionMammalianPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_2
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only