We narrowed to 4,633 results for: IRES
-
Plasmid#65270PurposeST reporter only ( no hook) (RUSH system)DepositorInserttruncated sialyltransferase (ST6GAL1 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianMutationcontains only amino acids 1 to 43 of STPromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR del52-linker-Venus-KDEL
Plasmid#214786PurposeMammalian expression of human del52-linker-Venus-KDELDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR ins5-linker-Venus-KDEL
Plasmid#214787PurposeMammalian expression of human CALR ins5-linker-Venus-KDELDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR del52-linker-Venus
Plasmid#214788PurposeMammalian expression of human CALR del52-linker-VenusDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR ins5-linker-Venus
Plasmid#214789PurposeMammalian expression of human CALR ins5 -linker-VenusDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 res
Plasmid#214752Purposeexpresses human MR1 resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
MCAM-BirA*-HA
Plasmid#214472PurposeLentiviral vector for the expression of MCAM-BirA*-HA fusion protein in mammalian cells.DepositorInsertMCAM (MCAM Human)
UseGateway Cloning and LentiviralTagsBirA(R118G) and HA tagExpressionMammalianPromoterEF-1aAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pStr-KDEL_EPV-CXCL9-mCherry-SBP
Plasmid#170678PurposeExpresses ER-targeted streptavidin-KDEL (hook) and CXCL9-mCherry-SBP targeted to the ER lumen with an N-terminal EPV tripeptide (cargo) for RUSH.DepositorInsertsTagsSBP and mCherryExpressionMammalianMutationChanged threonine 23 to glutamate (T23E)PromoterIRES and T7Available SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCT-CMV-copGFP-Polß(L301R/V303R/V306R)-puro
Plasmid#128666Purposemammalian expression of copGFP-Polß(L301R/V303R/V306R: TM) protein with puromcyin selectionDepositorInsertPolB (POLB Human)
UseLentiviralTagscopGFPExpressionMammalianMutationL301R/V303R/V306RPromoterCMVAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
CSII-IDR2-owlTRIMCyp-FOS K283D Q287D
Plasmid#79068PurposeExpress owl monkey TRIMCyp K283D, Q287D in mammalan cellsDepositorInsertTRIM5Cyp (owl monkey) (K283D, Q287D)-FOS
TagsOneSTrEP-FLAGExpressionMammalianMutationChanged Lys 283 to Asp and Gln 287 to AspPromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV40-EF1a-hBCL10(1-114)-SO
Plasmid#75257Purposeretroviral expression vector for expression of StrepOne-Tagged human BCL10 (AS 1-116)DepositorInsertBcl10 (BCL10 Human)
UseRetroviralTagsStrepOne TagExpressionMammalianMutationAS 1-116 (CARD-domain)PromoterpMSCV-LTRs, EF1aAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPP7CP-myc-T2A-tagRFP
Plasmid#140262PurposeExpresses PP7CP in mammalian cellsDepositorInsertCoat protein of bacteriphage PP7
UseSynthetic BiologyTagsmyc-T2A-tagRFPExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A mKate2-hu_ncOGT K842M
Plasmid#154284PurposeEntry vector encoding mKate2-2xFLAG-OGT (O-GlcNAc Transferase; K842M variant, catalytic dead)DepositorInsertO-GlcNAc Transferase (OGT Human)
UseGateway CloningTags2x FLAG and mKate2MutationK842M mutation (Catalytic Inactive)Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-skywarp-CRISPR-resistant
Plasmid#134252PurposeLentivector encoding CRISPR-resistant skywarp form of Snrnp40 (missing exon 5)DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationdeleted amino acids 179-219, and mutated coding s…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-N3FLAG-TAF12
Plasmid#105593Purposeretrovirally express mouse TAF12 with 3*FLAG tag at N terminal, GFP marker and puro resistanceDepositorInsertfull length TAF12 with silent mutations, making it resistant to TAF12 shRNA#364 (Taf12 Mouse)
UseRetroviralTags3*FLAGExpressionMammalianMutationsilent mutations to make it resistant to the targ…PromoterMSCV-LTRAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL-SBP-EGFP-LAMP1
Plasmid#222317PurposeSynchronize the trafficking of LAMP1 from the ER.DepositorInsertStreptavidin-KDEL and LAMP1 fused to SBP-EGFP (LAMP1 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD63-SBP-mCherry
Plasmid#222326PurposeSynchronize the trafficking of CD63 from the ER.DepositorInsertStreptavidin-KDEL and CD63 fused to SBP-mCherry (CD63 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only