We narrowed to 5,149 results for: mag
-
Plasmid#245110PurposeInserts 500 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:500
UseOtherAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.400bp
Plasmid#245111PurposeInserts 400 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:400
UseOtherAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.300bp
Plasmid#245112PurposeInserts 300 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:300
UseOtherAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.200bp
Plasmid#245113PurposeInserts 200 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:200
UseOtherAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.100bp
Plasmid#245114PurposeInserts 100 bp of VSG-228 coding sequence in T. brucei rDNA spacer centered at AnTat1.1 position 694DepositorInsertVSG-228:100
UseOtherAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-PUR-VSG-228.100bp_offset
Plasmid#245115PurposeInserts 100 bp of VSG-228 coding sequence in T. brucei rDNA spacer overlapping AnTat1.1 position 694, centered around common VSG-228 insertionDepositorInsertVSG-228:100_offset
UseOtherAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-CAPS1-mKate2
Plasmid#245360PurposeMammalian expression of C-terminal mKate2-tagged rat CAPS1 wild typeDepositorAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB085
Plasmid#239637PurposePlant RNA Vision constructs with 164 bp gRNAs together with RFP inputDepositorInsertssfGFPn_Y66-P1_loop_01-stem01-gRNA09
gRNA10-stem_02-P1_loop_03-internal guide sequence-Ribozyme-sfGFPn_Y66
RFP
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB084
Plasmid#239636PurposePlant RNA Vision constructs with 123 bp gRNAs together with RFP inputDepositorInsertssfGFPn_Y66-P1_loop_01-stem01-gRNA07
gRNA08-stem_02-P1_loop_03-internal guide sequence-Ribozyme-sfGFPn_Y66
RFP
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXYB086
Plasmid#239638PurposePlant RNA Vision constructs with 325 bp gRNAs together with RFP inputDepositorInsertssfGFPn_Y66-P1_loop_01-stem01-gRNA11
gRNA12-stem_02-P1_loop_03-internal guide sequence-Ribozyme-sfGFPn_Y66
RFP
UseSynthetic BiologyExpressionPlantAvailable SinceJune 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
rsZACRO/pcDNA3
Plasmid#236199PurposeMammalian expression of rsZACRO, a positively reversibly photoswitchable fluorescent proteinDepositorInsertrsZACRO
ExpressionMammalianAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJethlpAmKate2Spc
Plasmid#206813PurposeTemplate for hlpA-mkate2 amplification associated with spectinomycin resistance geneDepositorInserthlpA
UseSynthetic BiologyTagsmKate2Mutation3insGAvailable SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2s-MannII-N-10
Plasmid#231769PurposeVisualization of Golgi in mammalian cells using mGold2sDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2s-Keratin-N-17
Plasmid#231767PurposeVisualization of Keratin in mammalian cells using mGold2sDepositorInsertmGold2s-Keratin-N-17 (KRT18 Human)
TagsmGold2sExpressionMammalianMutationV282LPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2t-MannII-N-10
Plasmid#231777PurposeVisualization of Golgi in mammalian cells using mGold2tDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2t-Keratin-N-17
Plasmid#231775PurposeVisualization of Keratin in mammalian cells using mGold2tDepositorInsertmGold2t-Keratin-N-17 (KRT18 Human)
TagsmGold2sExpressionMammalianMutationV282LPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME AmCyan (JDW 1151)
Plasmid#224485PurposeGateway compatible middle entry clone containing AmCyan cytosolic blue flourescent reporterDepositorInsertAmCyan
UseGateway CloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME V5 mScarlet-I (JDW 1323)
Plasmid#224487PurposeGateway compatible middle entry clone containing V5 tagged m-Scarlet-I (Cytosolic far red fluorescent reporter)DepositorInsertV5-mScarlet-I
UseGateway CloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME iCre-I (JDW 1203)
Plasmid#224520PurposeA Gateway compatible middle entry clone containing a loxP flanked, self inactivating Cre that contains an intron to prevent recombination in bacteriaDepositorInsertiCre-I
UseCre/LoxAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only