We narrowed to 608 results for: Anti-CRISPR
-
Plasmid#104796PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g101120, Medtr2g101130 (Acre1). Also expresses Cas9 from Gmubi promoter from AtUBQ10 promoterDepositorInsertMedtr2g101120, Medtr2g101130
UseCRISPRExpressionPlantAvailable sinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TC9
Plasmid#202088Purposeentry vector for gateway recombination of TevCas9 and sgRNA into a destination cassette in pCitro-destDepositorInsertTevCas9 + sgRNA cassette
UseCRISPRAvailable sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMB28
Plasmid#223011PurposeCas12a and Csy4 with 5' and 3' targets (I) for Nicotiana leaf assayDepositorInsertCas12a and Csy4 with 5' and 3' targets (I)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMpGWBhis03-Citrine-NLS
Plasmid#188558PurposeBinary vector for the expression of Citrine-NLS with MpIGPDm selective marker in Marchantia polymorpha (igpd mutants) .DepositorInsertCitrine-NLS and MpIGPDm
UseCRISPR and Gateway CloningAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMB20
Plasmid#223004PurposeCsy4 with 5' and 3' targets (I) and without Cas for Lotus callus assayDepositorInsertCsy4 with 5' and 3' targets (I)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB21
Plasmid#223005PurposeCsy4 with 5' and 3' targets (II) and without Cas for Lotus callus assayDepositorInsertCsy4 with 5' and 3' targets (II)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB23
Plasmid#223007PurposeCsy4 with 5' and 3' targets (I) and without Cas for Nicotiana leaf assayDepositorInsertCsy4 with 5' and 3' targets (I)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA-Target1 (MpRTN1)
Plasmid#186291PurposeGateway entry vector for sgRNA (target 1: MpRTN1). Transient expression of sgRNA (Target 1: MpRTN1) for MpRTN1 in plant cellsDepositorInsertsgRNA-Target1
UseCRISPRAvailable sinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMB22
Plasmid#223006PurposeControl plasmid without Cas and Csy4 for Lotus callus assayDepositorInsertNot applicable, control plasmid
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB24
Plasmid#223008PurposeControl plasmid without Cas and Csy4 for Nicotiana leaf assayDepositorInsertNot applicable, control plasmid
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB26
Plasmid#223009PurposeCas12a and Csy4 with 5' target (I) for Nicotiana leaf assayDepositorInsertCas12a and Csy4 with 5' target (I)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB27
Plasmid#223010PurposeCas12a and Csy4 with 3' target (I) for Nicotiana leaf assayDepositorInsertCas12a and Csy4 with 3' target (I)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB45
Plasmid#223012PurposeCas12a and Csy4 with 5' and 3' targets (I) for Lotus callus assayDepositorInsertCas12a and Csy4 with 5' and 3' targets (I)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB51
Plasmid#223013PurposeCas12a and Csy4 with 5' and 3' targets (II) for Lotus callus assayDepositorInsertCas12a and Csy4 with 5' and 3' targets (II)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB61
Plasmid#223014PurposeCas12a and Csy4 with 5' and 3' targets (I) for Nicotiana leaf assayDepositorInsertCas12a and Csy4 with 5' and 3' targets (I)
UseCRISPRExpressionPlantAvailable sinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgGFP
Plasmid#190899PurposeAAV vector expressing sgGFPDepositorInsertsgRNA
UseAAV and CRISPRPromoterU6Available sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-sgRNA-Target1 (MpRTN1)
Plasmid#186295PurposeBinary vector for CRISPR/Cas9 (target 1: MpRTN1) in plants (for Agrobacterium-mediated genetic transformation)DepositorInsertsgRNA-Target1
UseCRISPRExpressionBacterialAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCI-SMN2-inclusion-GLuc
Plasmid#218671PurposeAlternative splicing signaling: signal increased with Ex7 inclusion increasingDepositorInsertSMN2 (SMN2 )
ExpressionMammalianAvailable sinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only