We narrowed to 15,275 results for: grn
-
Plasmid#253559PurposepegRNA to efficiently tag C-term of CDK4 with mNG11, integrated through Sleeping Beauty transposaseDepositorInsertpegRNA: CDK4, insert mNG11
UseUnspecifiedAvailable sinceSept. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSB-pegRNA-ESYT1-Nterm-NG11-60bp-Puro
Plasmid#253561PurposepegRNA to efficiently tag N-term of ESYT1 with mNG11, integrated through Sleeping Beauty transposaseDepositorInsertpegRNA: ESYT1 insert mNG11
UseUnspecifiedAvailable sinceSept. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSB-pegRNA-NUFIP2-Cterm-NG11-60bp-Puro
Plasmid#253562PurposepegRNA to efficiently tag C-term of NUFIP2 with mNG11, integrated through Sleeping Beauty transposaseDepositorInsertpegRNA: NUFIP2, insert mNG11
UseUnspecifiedAvailable sinceSept. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSB-pegRNA-COPG1-Cterm-NG11-60bp-Puro
Plasmid#253560PurposepegRNA to efficiently tag C-term of COPG1 with mNG11, integrated through Sleeping Beauty transposaseDepositorInsertpegRNA: COPG1, insert mNG11
UseUnspecifiedAvailable sinceSept. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSB-pegRNA-TRIM28-Nterm-NG11-60bp-Puro
Plasmid#253563PurposepegRNA to efficiently tag N-term of TRIM28 with mNG11, integrated through Sleeping Beauty transposaseDepositorInsertpegRNA: TRIM28, insert mNG11
UseUnspecifiedAvailable sinceSept. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-gRNA2.1-tub-miRFP680-T2A-HO1(HA)
Plasmid#250795PurposeDrosophila transgenic vector: nMAGIC vector with tub promoter, 3x HA tags, miRFP680, and HO1. Optimized nMAGIC vector with a far red/infra red FP marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable sinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310)
Plasmid#242662PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and mouse gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_mouse_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (human) (LLH301)
Plasmid#242661PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and human gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_human_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable sinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
AgU6.695&557_3xP3-DsRed1-SV40 (Tandem 1_2 gRNAs)
Plasmid#243012PurposeFor cloning two gRNAs in tandem after BspQI digestion under An. gambiae U6.695 and U6.557 promoters.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionInsectAvailable sinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231367PurposePle155-driven EGFP, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertEGFP
UseAAVAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
1203U-U6-gRNA-pCMV-wtCas9-NG-P2A-mcherry-3'dmDR
Plasmid#221448PurposeExpresses wtCas9-NG with double processed direct repeats (15nt) and a non-target spacer in between at 3' end, mCherry tag, and the gRNA targeting HEK293T-site3DepositorInsertswtCas9-NG
mCherry
UseCRISPRExpressionMammalianAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-mU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228361PurposemU6-driven expression of RfxCas13d gRNAs and arrays. Contains AarI sites for guide cloning.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-p120catenin(Canis)-exon4 116-138 gRNA
Plasmid#209923PurposeA knock-out vector for the dog CTNND1DepositorInsertA gRNA targeting the dog CTNND1 gene.
UseCRISPR and LentiviralAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-EF1a-DIO Chronos-eGFP(with gRNA scaffold)
Plasmid#199582PurposeExpresses Chronos-eGFP in a Cre-dependent mannerDepositorInsertChronos eGFP
UseAAV, CRISPR, and Cre/LoxTagsGFPExpressionMammalianPromoterEF1a intron AAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177360PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression from Synapsin promoterDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterSynapsine promoter and U6 promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177365PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expressionDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterCMV and U6 promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-nick sgRNA
Plasmid#214101PurposeLentiviral vector expressing nicking sgRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two sgRNAs using independent U6 promoters.DepositorInsertEGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only