We narrowed to 24,482 results for: c-myc
-
Plasmid#232726PurposeGvpN to GvpV genes knockin at the GAPDH locusDepositorInsertGvpN to GvpV
ExpressionMammalianAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBEL2837
Plasmid#231676PurposeExpresses a rabbit IgH signal peptide fused to GFP in mammalian cellsDepositorInsertRabbit IgH-sfGFP
TagssfGFPExpressionMammalianAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_eGFP-pScaE
Plasmid#228826PurposeFor the expression of the passenger domain of the Orientia tsutsugamushi protein ScaE in HeLa Flp-In cellsDepositorInsertScaE
TagseGFPExpressionMammalianMutationaa 49-494Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_eGFP-pScaD
Plasmid#228825PurposeFor the expression of the passenger domain of the Orientia tsutsugamushi protein ScaD in HeLa Flp-In cellsDepositorInsertScaD
TagseGFPExpressionMammalianMutationaa 30-700Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_eGFP-pScaC
Plasmid#228824PurposeFor the expression of the passenger domain of the Orientia tsutsugamushi protein ScaC in HeLa Flp-In cellsDepositorInsertScaC
TagseGFPExpressionMammalianMutationaa 33-223Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_eGFP-pScaA
Plasmid#228823PurposeFor the expression of the passenger domain of the Orientia tsutsugamushi protein ScaA in HeLa Flp-In cellsDepositorInsertScaA
TagseGFPExpressionMammalianMutationaa 25-1216Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM211 His-Ubp6
Plasmid#226359PurposeExpression of yeast Ubp6DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-DMRTC2
Plasmid#222548PurposePiggyBac transposon plasmid for doxycycline inducible expression of DMRTC2DepositorInsertDMRTC2 (DMRTC2 Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-DPPA3
Plasmid#222578PurposePiggyBac transposon plasmid for doxycycline inducible expression of DPPA3DepositorInsertDPPA3 (DPPA3 Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ANHX
Plasmid#222549PurposePiggyBac transposon plasmid for doxycycline inducible expression of ANHXDepositorInsertANHX (ANHX Human)
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCALPS-EGFP-Cre
Plasmid#207132PurposeLentiviral vector to express EGFP-CreDepositorInsertEGFP-Cre
UseLentiviralPromoterSSFVAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_15 [CEN6/ARSH4 ORI]
Plasmid#198928PurposeLevel 0 partDepositorInsertCEN6/ARSH4 ORI
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB3682
Plasmid#187807PurposeTranscriptional unit for expression of alcohol O-acetyltransferase from Saccharomyces pastorianus strain CBS 1483 chromosome SeVIII-SeXV, codon optimized for Nicotiana.DepositorInsertSpATF1-2
ExpressionPlantAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
LDB221
Plasmid#185427PurposeBacterial expression of Nup1 C-terminal residues 777-1076 as GST fusionDepositorInsertNUP1
TagsGSTExpressionBacterialMutationNup1 C-terminal residues 777-1076Available SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only