We narrowed to 16,006 results for: grna
-
Plasmid#246933Purposefor HEK293T human cell genome editingDepositorInsertLaTranC sgRNA
UseCRISPRAvailable sinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW493_U6-sgRNA-entry
Plasmid#244823PurposeMammalian expression of SpyCas9 single guide RNA with Golden Gate-compatible sgRNA spacerDepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPP21 (pAVA3259)
Plasmid#239327PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPP21DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPP21 (RPP21 Human)
UseCRISPR and LentiviralAvailable sinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-sgRNA GLB1
Plasmid#184378PurposeExpresses a sgRNA to edit GLB1 gene NM_000404.2_c.907A>GDepositorAvailable sinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_BRF2 (pAVA3258)
Plasmid#239326PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting BRF2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting BRF2 (BRF2 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPPH1 (pAVA3586)
Plasmid#239328PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1 (RPPH1 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_D11 (pAVA3773)
Plasmid#239310PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and a non-targeting sgRNA as control(-)DepositorInsertU6-driven non-targeting sgRNA Control(-)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiCRISPR-B_sgRNA_POP1 (pAVA3497)
Plasmid#239311PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting POP1DepositorInsertU6-driven sgRNA targeting POP1 (POP1 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP38 (pAVA3523)
Plasmid#239313PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP38DepositorInsertU6-driven sgRNA targeting RPP38 (RPP38 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP29 (pAVA3545)
Plasmid#239314PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP29DepositorInsertU6-driven sgRNA targeting RPP29 (POP4 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_POP5 (pAVA3498)
Plasmid#239315PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting POP5DepositorInsertU6-driven sgRNA targeting POP5 (POP5 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP20 (pAVA3546)
Plasmid#239316PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP20DepositorInsertU6-driven sgRNA targeting RPP20 (POP7 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP14 (pAVA3507)
Plasmid#239317PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP14DepositorInsertU6-driven sgRNA targeting RPP14 (RPP14 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by