173,439 results
-
Plasmid#63670PurposeExpresses Cas9 nuclease and the PITCh-gRNADepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5428_pHR_EF1a-mCherry-P2A-Rfx_Cas13d-2xNLS-3xFLAG
Plasmid#155305PurposeLentiviral vector encoding Rfx Cas13d fused with 2xNLS, 3xFLAG, and 2A-tagged mCherry.DepositorInsertmCherry 2A-tagged to Ruminococcus flavefaciens XPD3002 Cas13d
UseLentiviralTags2xNLS-3xFLAGExpressionMammalianPromoterEF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-NR1a
Plasmid#17928DepositorAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SIRT2 Flag
Plasmid#13813PurposeMammalian expression of human SIRT2 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCBh-NLS_dCas13d_HA_NLS-pA-U6-DR-BpiI-BpiI-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#191797Purposevector for encoding a human codon-optimized dead RfxCas13d (dCas13d) driven by CBh promoter, guide RNAs compatible with RfxCas13d driven by hU6, EGFP driven by SV40 promoter, and mCherry driven by SV40 promoterDepositorInserthumanized dCas13d
UseCRISPRExpressionMammalianMutationR239A, H244A, R858A, H863APromoterCBh, SV40, hU6Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
HDAC6 Flag
Plasmid#13823PurposeMammalian expression of human histone deacetylase 6 with flag tagDepositorAvailable SinceFeb. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
-
pACEBac1-beta-actin
Plasmid#178076PurposeInsect cell expression of beta-actinDepositorInsertbeta-actin (ACTB Human)
ExpressionInsectAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
R777-E095 Hs.FNTB
Plasmid#70379PurposeGateway ORF clone of human FNTB [NM_002028.3] with stop codon (for native or N-terminal fusions)DepositorInsertFNTB (FNTB Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7-P2A-BSD
Plasmid#224122PurposeMammalian expression of SpCas9 PE7 prime editor with P2A-BSD markerDepositorInsertPE7-P2A-BSD
TagsP2A-BSD, SV40 bpNLS, and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
NbV5-HiBiT
Plasmid#201489PurposeNanoBit detection of V5-tagged proteinDepositorInsertNbV5-HiBiT
TagsHiBitExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_hsHAUScomplex_FL
Plasmid#202203PurposeBaculoviral transfer vector to co-express 8 subunits of human augmin complexDepositorInsertsHAUS1 (HAUS1 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS3 (HAUS3 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS2 (HAUS2 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS6 (HAUS6 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS7 (HAUS7 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS4 (HAUS4 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS5 (HAUS5 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS8 (HAUS8 codon-optimized form for expression in Trichoplusia ni cells, Human)
Tags-mGFP-TEV-TwinStrep and His-tag (6x)ExpressionInsectPromoterpolyhedrin promoterAvailable SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-GCP5
Plasmid#178071PurposeInsect cell expression of GCP5DepositorInsertGCP5 (TUBGCP5 Human)
ExpressionInsectAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-LOV*-MVP
Plasmid#202206PurposeExpresses the photoproximity labeling catalyst LOV* fused to MVP in mammalian cellsDepositorAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV asyn S129E
Plasmid#36068DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PTPN3
Plasmid#38966PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMVTO-TVMVP
Plasmid#179659PurposeTobacco Vein Mottling Viral ProteaseDepositorInsertTVMVP
ExpressionMammalianAvailable SinceMarch 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-fDIO-mNeonGreen
Plasmid#99133PurposeAn AAV genome with Flp recombinase-dependent expression of mNeonGreen from the CAG promoterDepositorHas ServiceAAV1InsertfDIO-mNeonGreen
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Mcm2-mVen
Plasmid#211398Purposemammalian expression of human Mcm2 C-terminally fused to mVenusDepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only