Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LZRS ERTm RasV12
(Plasmid #21199)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21199 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LZRS no LacZ
  • Backbone size w/o insert (bp) 11100
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    STBL2
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EsR1- HRas
  • Alt name
    mouse Esr1 upstream of human HrasG12V
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    1700
  • Mutation
    Esr1 G257R; HRasG12V ERTm bx3
  • Entrez Gene
    Esr1 (a.k.a. E, ER, ER-, ER-alpha, ER[, ERa, ERalpha, ESR, Es, Estr, Estra, Nr, Nr3a1)
  • Entrez Gene
    HRAS (a.k.a. C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV, HRAS1, RASH1, p21ras)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGGATACACGCCGCCCACGTG
  • 3′ sequencing primer ATCGTCGACCACTGTGCTGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LZRS ERTm RasV12 was a gift from Paul Khavari (Addgene plasmid # 21199 ; http://n2t.net/addgene:21199 ; RRID:Addgene_21199)
  • For your References section:

    Epidermal Ras blockade demonstrates spatially localized Ras promotion of proliferation and inhibition of differentiation. Dajee M, Tarutani M, Deng H, Cai T, Khavari PA. Oncogene. 2002 Feb 28;21(10):1527-38 10.1038/sj.onc.1205287 PubMed 11896581