Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LZRS ERTm RasN17
(Plasmid #21198)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21198 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    LZRS no LacZ
  • Backbone size w/o insert (bp) 11100
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl2
  • Growth instructions
    STBL2
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HRas
  • Alt name
    Esr1
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    1700
  • Mutation
    S17N ERTm bx3
  • Entrez Gene
    Esr1 (a.k.a. ER, ER-alpha, ERa, ERalpha, ESR, Estr, Estra, Nr3a1)
  • Entrez Gene
    HRAS (a.k.a. C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV, HRAS1, RASH1, p21ras)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TGGATACACGCCGCCCACGTG
  • 3′ sequencing primer ATCGTCGACCACTGTGCTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LZRS ERTm RasN17 was a gift from Paul Khavari (Addgene plasmid # 21198 ; http://n2t.net/addgene:21198 ; RRID:Addgene_21198)
  • For your References section:

    Epidermal Ras blockade demonstrates spatially localized Ras promotion of proliferation and inhibition of differentiation. Dajee M, Tarutani M, Deng H, Cai T, Khavari PA. Oncogene. 2002 Feb 28;21(10):1527-38 10.1038/sj.onc.1205287 PubMed 11896581