173,439 results
-
Plasmid#175956PurposeGeneration of MS2 Virus-Like Particles packaged with the sequence for the Influenza B NSP 1 protein [B/Colorado/06/2017]DepositorInsertNEP gene
ExpressionBacterialPromoterT7Available SinceSept. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-hSyn-IvfChr-citrine-KV2.1
Plasmid#221615PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement and soma targeting with KV2.1 motif.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement and soma targeting
UseAAVMutationvfChrimson-citrine with membrane trafficking enha…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_luxR-PLuxB
Plasmid#204073PurposeType 0 promoter partDepositorInsertluxR-PLuxB repressor and PLuxB 3OC6-AHL-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_rhaS-PRhaB
Plasmid#204076PurposeType 0 promoter partDepositorInsertrhaS activator and PRhaB rhamnose-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSrtA-MT3
Plasmid#200305PurposeBacterial expression plasmids for self cleavable sortase mediated purification of recombinant MT3. Contains His-tag, SUMO-tag, LPETG sortase recognition motif and eSrtADepositorAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Rem2 R236A/L263A
Plasmid#51589Purposeexpresses RNAiR myc-tagged Rem2 non-Ca channel interactingDepositorInsertRem2 (Rem2 Mouse)
TagsmycExpressionMammalianMutationR236A and L263A; silent mutations at shRNA 1 and …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Cre
Plasmid#24064PurposeRetroviral coexpression of Cre and EGFPDepositorInsertCre
UseCre/Lox and RetroviralTagsEGFPExpressionMammalianPromoterMESV 5' LTRAvailable SinceOct. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPEmax-Hygro
Plasmid#214020Purposeinducible PEmax system for controllable prime editing; this plasmid is used to insert PEmax prime editor in one allele of AAVS1 locusDepositorInsertPEmax
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaM-4
Plasmid#172770PurposeBacterial expression of anti-mCherry nanobody LaM-4, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-4
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTIPI_mIGg2a_Anti-HA [12CA5]
Plasmid#210656PurposeMammalian expression of Anti-HA [12CA5] mouse IgG2a heavy chain; to be used with pTIPI_mK_Anti-HA [12CA5] light chain (Plasmid 210657) to make the antibody.DepositorInsertAnti-HA [12CA5] mouse IgG2a heavy chain
UseAffinity Reagent/ AntibodyTagsMouse IgG2a heavy chainExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTIPI_mK_Anti-HA [12CA5]
Plasmid#210657PurposeMammalian expression of Anti-HA [12CA5] mouse kappa light chain; to be used with pTIPI_mIGg2a_Anti-HA [12CA5] heavy chain (Plasmid 210656) to make the antibody.DepositorInsertAnti-HA [12CA5] kappa light chain
UseAffinity Reagent/ AntibodyTagsMouse kappa light chainExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBbA5a-sufABCDSE
Plasmid#195056PurposeExpresses SUF operon from E. coli from IPTG-inducible promoterDepositorInsertsufABCDSE
ExpressionBacterialAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pREDusk-MCS
Plasmid#188970PurposeFor red light-repressed bacterial expression of gene of interestDepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lac-I-SceI-Tet
Plasmid#17655DepositorInsertlac I-SceI tet
ExpressionBacterialAvailable SinceMay 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
ITGB1
Plasmid#51920PurposeExpresses full-length Integrin beta-1 precursor ectodomain in mammalian cells. Stop codon before C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertITGB1 (ITGB1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationStop Codon at amino acid 728, before CD4, bio and…PromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cre-MS2_UbC-GFP (Cre_GFP)
Plasmid#219536Purposea. Expresses Cre recombinase tagged with 21x repeats of MS2 binding sequence under EF1A promotor and b. GFP reporter under UbC promotorDepositorAvailable SinceNov. 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCS2+mNeonGreen-C Cloning Vector
Plasmid#128144PurposeTo express a protein of interest fused to the C-terminus of mNeonGreenDepositorTypeEmpty backboneTagsmNeonGreen fusionExpressionMammalianAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only