We narrowed to 17,027 results for: puromycin
-
Plasmid#174307PurposeLentiviral expression of GFPDepositorAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pMIR-His-Halo-Tev-PTEN
Plasmid#58241Purposeexpresses halo tagged PTEN proteinDepositorInsertphosphatase and tensin homolog (PTEN Human)
TagsHis-Halo-TevExpressionMammalianPromoterCMVAvailable SinceAug. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLPC-S22A-Progerin
Plasmid#69065Purposeencodes a Progerin mutant where serine 22 is mutated to an alanineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with serine 22 mutated to alaninePromoterCMVAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
1071 pBabe puroL myr Akt T308A S473A
Plasmid#9014DepositorInsertAkt1 T308A S473A (AKT1 Human)
UseRetroviralTagsHA and MyrExpressionMammalianMutationT308A S473AAvailable SinceNov. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLV-SI-121
Plasmid#131126PurposeA-to-G base editing reporterDepositorInsertmutant EGFP
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterCMV promoterAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-E2F7-T2A-PuroR
Plasmid#162348PurposeLentiviral expression of E2F7 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_AAVS1
Plasmid#184487PurposeLentivirus all in one CRISPR vector targeting human AAVS1 geneDepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
TFORF0853
Plasmid#143731PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF2636
Plasmid#142343PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX-FHH-MTORKinaseDomain
Plasmid#120708PurposeExpresses Flag-HA-6xHIS-Mtor Kinase Domain fusion protein in mammalian cells & for virus productionDepositorInsertMTOR Kinase Domain (MTOR Human)
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianMutationAmino acids 1967-2549PromoterCMVAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF0199
Plasmid#141551PurposeLentiviral vector for overexpressing the RFX2 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001148608)
Plasmid#77539Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF1524
Plasmid#143819PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0164
Plasmid#142547PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0642
Plasmid#143057PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1030
Plasmid#143461PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001146456)
Plasmid#77540Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF2897
Plasmid#143656PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only