We narrowed to 15,910 results for: grna
-
Plasmid#220927PurposeExpresses gfp using J23119 promoter and pgRNA_AT backboneDepositorInsertsuperfolder GFP
TagsFLAGExpressionBacterialPromoterJ23119Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA5
Plasmid#164930PurposeExpresses Non-targeting sgRNA5 control in mammalian cellsDepositorInsertNon-targeting sgRNA5 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_U6_AtPDS3_gRNA10
Plasmid#197965PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available sinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti.Cas9.BFP.sgRNA.parental
Plasmid#196715PurposeSortable WT-SpCas9 expression and guide cassette (1-vector system).DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197981PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#178107PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-53 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_TH1477_2xUGI_3xHA
Plasmid#136659PurposeExpresses St1BE4max-TH1477 in mammalian cells along with its U6-driven sgRNADepositorInsertsUseCRISPR and Synthetic BiologyTags2xUGI, APOBEC-1, SV40 NLS, UGI, and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:sgRNA-Ds
Plasmid#119069PurposeTo clone sgRNA spacer sequence for microinjections in zebrafishDepositorInsertU6a:sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable sinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
St1Cas9_LMD-9_sgRNA_pUC19
Plasmid#110627PurposeU6-driven sgRNA expression plasmid for Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9).DepositorInsertEmpty St1Cas9 LMD-9 sgRNA backbone
UseCRISPR and Synthetic BiologyTagsNoneExpressionMammalianPromoterhU6Available sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralPromoterbU6/mU6/hU6Available sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tail-8A8G
Plasmid#157981PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tail-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-Grpr1
Plasmid#175176PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting GrprDepositorInsertsgRNA-Grpr
UseAAV and CRISPRAvailable sinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCC_01 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE
Plasmid#139086PurposeExpresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBR322-sgRNA-pvc18-20-Pdp1_NTD-Cre
Plasmid#243748PurposePVC cargo/regulatory region - deleted toxin cargos (Pdp1/Pnf) - vegfa sgRNA - Cre loaded into the PVC tube via Pdp1 (NTD)DepositorInsertvegfa sgRNA-pvc18-20-Pdp1_NTD-Cre
ExpressionBacterialAvailable sinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR1-SV40-puro
Plasmid#240535PurposeLentiviral eBAR1 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only