We narrowed to 8,725 results for: chloramphenicol
-
Plasmid#253775PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBig2ab zz TEV YBBR POT1 ZZ TEV TPP1 MBP TEV TIN2 ZZ TEV TRF1 (4comp1)
Plasmid#185447PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF1 and TPP1 each with a zz tag and TEV site, and human TIN2 with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-His6-3xFlag/nsp7-Linker-nsp8 (SARS-CoV-2)
Plasmid#169184PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag and nsp7-Linker-nsp8 fusion in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7-Linker-nsp8 (ORF1ab Synthetic, SARS-CoV-2)
TagsHis6-3xFlag (nsp12 C-terminus) and nsp7-nsp8 fusi…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169164PurposeBaculoviral transfer vector to co-express SARS-CoV-2 nsp14 and nsp10 in insect cellsDepositorInsertnsp14/nsp10-6His-3xFlag (ORF1ab Synthetic, SARS-CoV-2)
Tags6His-3xFlag (nsp10 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPGK-DEST-IRES-Puro
Plasmid#253773PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Puro
Plasmid#253769PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-Puro
Plasmid#253777PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-Neo
Plasmid#253776PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-EGFP
Plasmid#253778PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to EGFP by an IRES.DepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-TRE-DEST-UbC-tTSrtTA-IRES-EGFP
Plasmid#253782PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to EGFP by an IRES.DepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPGK-DEST-IRES-Neo
Plasmid#253772PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Hygro
Plasmid#253767PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-DEST-IRES-Neo
Plasmid#253768PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-TRE-DEST-UbC-tTSrtTA-IRES-Puro
Plasmid#253781PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to puromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-hPGK-DEST-IRES-Hygro
Plasmid#253771PurposeThird generation lentiviral expression Gateway cloning destination vector under a hPGK promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-DEST-IRES-Neo
Plasmid#253766PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-TRE-DEST-UbC-tTSrtTA-IRES-Neo
Plasmid#253780PurposeThird generation lentiviral expression Gateway cloning destination vector under a Tet-On inducible promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only