Skip to main content

We narrowed to 16 results for: chloramphenicol

Showing: 1 - 16 of 16 results
  1. Plasmids 101: E. coli Strains for Protein Expression

    Type
    Blog Post
    ...General protein expression BL21 (DE3) pLysS* Chloramphenicol (pLysS) pLysS expresses T7 lysozyme to reduce...Expression of toxic proteins BL21 (DE3) pLysE* Chloramphenicol (pLysE) pLysE has higher T7 lysozyme expression...Expression of insoluble proteins  Rosetta2 (DE3)* Chloramphenicol (pRARE) Good for “universal” translation; contains...Expression of eukaryotic proteins Lemo21 (DE3)* Chloramphenicol (pLemo) Rhamnose-tunable T7 RNAP expression...T7 expression. The pLys plasmid contains a chloramphenicol resistance cassette for positive selection ...
  2. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...exchange vector. This vector contains sacB, an chloramphenicol resistance cassette, and the R6K origin of ...products. To allow manipulation of naturally chloramphenicol-resistant strains, we have also included versions...
  3. Working with Nuclear Receptors

    Type
    Blog Post
    ...reporter gene has over the years evolved from chloramphenicol acetyltransferase to luciferase, the basic ...
  4. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae Chloramphenicol yes, cut Marraffini 44251 pgRNA-bacteria BBa_J23119...
  5. Pouring LB Agar Plates

    Type
    Protocol
    ...5 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Coumermycin...
  6. Sequencing Primers

    Type
    Guide
    ...Reverse CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG...
  7. Molecular Biology Reference

    Type
    Guide
    ...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in Ethanol) 25 µg/mL Hygromycin...
Showing: 1 - 16 of 16 results