We narrowed to 2,304 results for: fas
-
Plasmid#124805PurposeHDR template to knock-in mouse IgG3 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG3 producing cell lines.DepositorInsertMurine IgG3
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7190
Plasmid#219763PurposeMoClo-compatible Level M for expression nnLuz, nnH3H, nnCPH in plants (N.benthamiana, BY2 cells)DepositorInsertnnLuz, nnH3H, nnCPH
ExpressionPlantAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX030
Plasmid#167154PurposeMoClo-compatible Level 1 (position 5) vector encoding Neonothopanus nambi caffeoylpiruvate hydrolase nnCPH under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnCPH-ocsT
ExpressionPlantPromoterp35sAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCPF101-pfQC-cyclase dead
Plasmid#184878Purposeexpresses soluble plasmodium falciparum QC protein with a histag, cyclase dead mutantDepositorInsertpfQC-cyclase dead
TagsHis tagExpressionBacterialMutationF77A & Q79AAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>Fab-srt-his
Plasmid#124810PurposeHDR template to knock-in sortag and histag in rat IgG2a heavy chain locus. Use in combination with PX459-gR2A_Hinge to convert rat IgG2a hybridoma to Fab' fragment producing cell lines.DepositorInsertrat IgG2a Hinge-G4S-Sortag-Histag
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterialPromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
FBE-Luc
Plasmid#16526DepositorAvailable SinceMarch 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRU324
Plasmid#167691PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFGAMS-mEos2
Plasmid#105128PurposeExpresses human FGAMS-mEos2 fusion in mammalian cellsDepositorAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFGAMS-mCherry
Plasmid#166024PurposeExpresses human PFAS-mCherry fusion in mammalian cellsDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCoofy28
Plasmid#44004DepositorTypeEmpty backboneTagsHis6-GSTExpressionInsectPromoterPPHAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDGE347
Plasmid#153228PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
FBE/SBE-Luc
Plasmid#16525DepositorInsertFBE/SBE
UseLuciferaseTagsluciferaseExpressionMammalianAvailable SinceMarch 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDGE687
Plasmid#167299PurposeVector for plant genome editing containing p35S:GFP-Cas9 expression cassette, nptII selection marker, and SlFAST2 and Ca-Bs3 counterselction markers, but not sgRNAs.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCoofy27
Plasmid#44003DepositorTypeEmpty backboneTagsHis6ExpressionInsectPromoterPPHAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCoofy29
Plasmid#44005DepositorTypeEmpty backboneTagsHis6-MBPExpressionInsectPromoterPPHAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only