We narrowed to 2,319 results for: fas
-
Plasmid#219760PurposeMoClo-compatible Level 1 for expression PzPKS2 in plants (N.benthamiana, BY2 cells)DepositorInsertPzPKS2
ExpressionPlantPromoterp35s_0.4kb - 5'UTR TMV omegaAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7180
Plasmid#219762PurposeMoClo-compatible Level 1 for expression HmS in plants (N.benthamiana, BY2 cells)DepositorInsertHmS
ExpressionPlantPromoterp35s_0.4kb - 5'UTR TMV omegaAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7191
Plasmid#219764PurposeMoClo-compatible Level M for expression PpASCL in plants (N.benthamiana, BY2 cells)DepositorInsertPpASCL
ExpressionPlantAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7181
Plasmid#219766PurposeVector for expression HmS in yeast (P.pastoris)DepositorInsertHmS
ExpressionYeastPromoterpGAPAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7182
Plasmid#219767PurposeVector for expression PpASCL in yeast (P.pastoris)DepositorInsertPpASCL
ExpressionYeastPromoterpGAPAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7188
Plasmid#219768PurposeVector for expression Pv4CL1 in yeast (P.pastoris)DepositorInsertPv4CL1
ExpressionYeastPromoterpGAPAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEos2-dVHH[GFP] in pCSDEST
Plasmid#162870PurposeSuper-resolution of GFP in cultureDepositorInsertmEos2-dVHH[EGFP]
TagsmEos2ExpressionMammalianAvailable sinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-Gas5
Plasmid#213172PurposeCIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and Gas5 guide RNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-Calm3-U6-Gas5 gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available sinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX026
Plasmid#167153PurposeMoClo-compatible Level 1 (position 4) vector encoding Neonothopanus nambi luciferase nnLuz with C-terminal His-tag under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnLuz-ocsT
UseLuciferaseTagsHis6-tagExpressionPlantPromoterp35sAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHybr_r2a>mG3-srt-his
Plasmid#124805PurposeHDR template to knock-in mouse IgG3 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG3 producing cell lines.DepositorInsertMurine IgG3
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK7190
Plasmid#219763PurposeMoClo-compatible Level M for expression nnLuz, nnH3H, nnCPH in plants (N.benthamiana, BY2 cells)DepositorInsertnnLuz, nnH3H, nnCPH
ExpressionPlantAvailable sinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX030
Plasmid#167154PurposeMoClo-compatible Level 1 (position 5) vector encoding Neonothopanus nambi caffeoylpiruvate hydrolase nnCPH under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnCPH-ocsT
ExpressionPlantPromoterp35sAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCPF101-pfQC-cyclase dead
Plasmid#184878Purposeexpresses soluble plasmodium falciparum QC protein with a histag, cyclase dead mutantDepositorInsertpfQC-cyclase dead
TagsHis tagExpressionBacterialMutationF77A & Q79AAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>Fab-srt-his
Plasmid#124810PurposeHDR template to knock-in sortag and histag in rat IgG2a heavy chain locus. Use in combination with PX459-gR2A_Hinge to convert rat IgG2a hybridoma to Fab' fragment producing cell lines.DepositorInsertrat IgG2a Hinge-G4S-Sortag-Histag
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterialPromoterpUCAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by