We narrowed to 67 results for: Drosophila

...can be used to replace genes in yeast, mice, or Drosophila through homologous recombination. The concept...

...by members of the worm community but there are Drosophila and zebrafish articles published there as well...

...your vector, which are: Organism (Mammalian or drosophila) Delivery type (lentivirus, AAV, transposon,...

... RNA targeting Cas system that can be used in Drosophila melanogaster. Get the plasmids at Addgene The...

...expression can be toxic in some systems, such as Drosophila and mouse, particularly in proliferating cells...New Methods for Site-specific Recombination in Drosophila Teaching an Old DOG New Tricks: Controlling Protein...

...activation levels than SAM in some loci across Drosophila cell lines (Sajwan et al., 2019). SPH SPH combines...

...genes: deletion mapping functional domains of Drosophila hsp 70. Embo J 3:3087–3093. https://doi.org/10.1002...

...Washington University whose research focuses on Drosophila-parasite pathogen interactions.  ...

...sources – voltage-gated potassium channels found in Drosophila to phosphatases from sea squirts. This design...

...analyzing protein–protein interactions in live Drosophila. eLife 7. https://doi.org/10.7554/elife.38853...

...genes: deletion mapping functional domains of Drosophila hsp 70." The EMBO journal 3.13 (1984): 3087. ...

...communities using them grow. So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both...

...(but not limited to) bacteria, yeast, plants, drosophila, worms and mammals (Browse plasmids by model ...

... Expression - Rubin lab plasmids for Drosophila expression pMT-puro - Inducible... plasmid with N-terminal Myc tag and attB for Drosophila transgenesis His Epitope tag pEZYmyc-His - C-...

...DNA-Binding Protein 165579 pOpen-dromedNK dNK from Drosophila 165580 pOpen-BovDNTT Bovine DNTT 165555 pOpen-ALPI...

...different academic labs, targeting mouse, human, Drosophila melanogaster, and T. gondii are available through...

...generation of germline mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 -...

...homolog 2 (Drosophila) KIAA1568, SAX3 ROBO3 roundabout, axon guidance receptor, homolog 3 (Drosophila) FLJ21044...homolog 1 (Drosophila) MEGF4, MGC164811, SLIL1, SLIT3, Slit-1 SLIT2 slit homolog 2 (Drosophila) FLJ14420...homolog 1 (Drosophila) GF1, GGF1, GINGF, HGF, NS4 SOS2 son of sevenless homolog 2 (Drosophila) FLJ25596...roundabout, axon guidance receptor, homolog 1 (Drosophila) DUTT1, FLJ21882, MGC131599, MGC133277, SAX3 ...

... 5' end of Drosophila mini-white gene Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC...mCherry Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC...U6 promoter Forward Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene Forward V5 Reverse ACCGAGGAGAGGGTTAGGGAT...

...for a discussion on conversion tract length in Drosophila. Elliot et al. (1998) suggests mammalian cells...