Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Showing: 1 - 3 of 3 results
  1. Sequencing Primers

    Type
    Guide
    ...end of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter... primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor...Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) Drosophila heat shock promoter, forward primer EF-1a Forward...primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F...promoter, forward primer Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene, forward primer V5 Reverse...
  2. Promoters

    Type
    Guide
    ...promoter for small RNA expression UAS Specific Drosophila promoter containing Gal4 binding sites Bacterial...
  3. Optogenetics Guide

    Type
    Guide
    ... in model organisms like mice, zebrafish, and Drosophila. These tools have been instrumental in neurological...
Showing: 1 - 3 of 3 results