We narrowed to 5 results for: Drosophila
-
TypeGuide... 5' end of Drosophila mini-white gene Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC...mCherry Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC...U6 promoter Forward Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene Forward V5 Reverse ACCGAGGAGAGGGTTAGGGAT...
-
Promoters
TypeGuide... Ac5 Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires...regulatory element and yeast Gal4 gene; often used in Drosophila Polyhedrin Constitutive Insect Strong promoter... -
Modular Cloning Guide
TypeGuide...Genome Engineering, CRISPR, Mammalian Expression, Drosophila John Doench 180-plasmid toolkit for rapid creation... -
Optogenetics Guide
TypeGuide... in model organisms like mice, zebrafish, and Drosophila. These tools have been instrumental in neurological... -
CRISPR Guide
TypeGuide...are also available, such as those for yeast or Drosophila . Although CRISPR has been less widely used in...