We narrowed to 94 results for: mCherry

...plasmids for purification of tTALE-eGFP and tTALE-mCherry. In comparison to intercalating fluorescent dyes...

...followed by an internal ribosomal entry site and mCherry. If a variant has wild-type levels of abundance...

...sensor for zinc using variants of mOrange2 and mCherry as donor and acceptor domains. He says, these new...

...The pooled library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you...

... open for a longer duration upon activation. p-mcherry-C1-iC++_CA - A slow cycling (open for minutes) ...

... commonly used red fluorescent proteins dsRed, mCherry, and TdTomato do not induce transcription. Thus...

...binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry Forward mCherry-R TTGGTCACCTTCAGCTTGG...TTGGTCACCTTCAGCTTGG 5' end of mCherry Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward...

...assess Cas9-PAGE editing with viral sgRNA targeting mCherry reporter (mChe), with co-incubation with assist...

...containing several types of fluorescent (EGFP, tagRFP, mCherry) and nonfluorescent (Halo, SNAP) tags, a selectable...

...system pairs ubiquitous expression of sgRNA(s) and mCherry (vector 1) with neuron-specific expression of dCas9...

...developed monomeric fluorescent proteins mKO and mCherry, respectively. While Tsuboi et al developed mK-...

...the tyrosine-protein kinase Lyn) Membranes 3 mCherry 587nm/ 610 nm human β-Actin Actin 4 Citrine 516nm...

... which cannot form heterodimers (i.e. EGFP and mCherry). These simple strategies can help you make better...

...Retroviral pWPI IRES Lentiviral AmCyan-P2A-mCherry P2A Mammalian pC5Kan-P2A P2A Insect pUltra ...

... are named for soup ingredients! From pSOUP to mCherry, satisfying ingredients reagents permeate the molecular...

...mTurquoise2, mEGFP, mNeonGreen, mScarlet(-I), and mCherry. Keep the linker sequence short In the early days...

...is delivered using a vector that also expresses mCherry to mark transfected cells. The nanobody recruits...

...cassettes, such as fluorescent proteins (EGFP, mCherry etc.), recombinases (Cre, Flp etc.), and tetracycline...

...channelrhodopsin-2, ChR2) fused to a reporter gene (e.g., mCherry) to easily detect opsin-expressing cells. The resulting...

...them with a fluorescent reporter, such as GFP or mCherry, through genetic modification. As your protein ...