Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 2 of 2 results

  1. Sequencing Primers

    Type
    Guide
    ...forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry, forward primer mCherry-R TTGGTCACCTTCAGCTTGG...TTGGTCACCTTCAGCTTGG 5' end of mCherry, reverse primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein...

  2. Optogenetics Guide

    Type
    Guide
    ...optogenetics procedure. A channelrhodopsin, fused to mCherry, is expressed in neurons (red dots). When exposed...
Showing: 1 - 2 of 2 results