...cell and regulates the switch from anabolic to catabolic processes. Active mTORC1 promotes protein and ...energy-intensive processes. mTORC1 also blocks catabolic processes including autophagy and lysosome biogenesis... below. Color is used for clarity and does not indicate a specific relationship. The content for this ...Pathway Color is used for clarity and does not indicate a specific relationship. The content for this ...Pyruvate dehydrogenase kinase, isozyme 1 PI3K Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PKC PKC alpha...

... nuclease along with the guide RNA. For most applications, we recommend using Cas9 with the single guide...BbsI, and a pair of annealed oligos (design is indicated below) can be cloned scarlessly into the vector...BbsI, and a pair of annealed oligos (design is indicated below) can be cloned into the CRISPR array. The...61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven SpCas9; for neuronal expression...expressing human codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing...function of genetic elements. To broadly enable the application of Cas9 in vivo and ex vivo , the Zhang Lab established...can be combined with Cas9 in a wide range of applications. Full references are below. The Cas9 knockin...

...recognizes 34 bp loxP sites, and the orientation and location of the loxP sites determines how the genetic material...of rearrangements: inversion, deletion, and translocation. Figure 1. Recombination outcomes are determined...are on separate DNA molecules (in trans), a translocation event is generated between the target sites....present. By expressing Cre at specific times or locations, you can precisely control expression of your ...constructs also contain fluorescent labels that indicate if recombination has occurred, allowing for direct...(pos36)GFP-9xGGS-Cre-6xHis Cre fused to highly cationic GFP variant T7 Bacterial Liu 62939 pET-Cre-6xHis...Mammalian Sato 122961 pcDNA3.1_PA-Cre-Y324F Catalytically inactive PA-Cre CMV Mammalian Sato 123128 pET-His-Cre...

...the most abundant forms of posttranslational modifications in cells and research into its many roles in...Importantly, phosphorylation positional isomers are allocated to different subpools, allowing precise knowledge...-EFSep) Plasmid 34624 SepOTSα tRNA-Sep ( aka. pCAT112TAG-SepT) Plasmid 68283 SepOTSβ Plasmid 68284 SepOTSγ...phosphopeptides in bacteria for proteome-wide identification of phosphorylation-dependent interactions. ...Rogulina S, Isaacs FJ, and Rinehart J. Nature Communications . 2015. 6, 8130. PubMed (Link opens in a new...Isaacs FJ, Rinehart J, and Jewett MC. Nature Communications . 2015. 6, 8168. PubMed (Link opens in a new...

...Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication Yeast ID Plasmid...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts A catalytically inactive Cas9 (dCas9) is fused to FokI nuclease...Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids that should be added...

...Genomic Tools for library construction, genomic modification, and cloning systems. Jump to Table: Cloning... or sort by the table headings. Click on the publication link to view all plasmids available from the ...Plasmid Description Gene/Insert Vector Type PI Publication Back to Top Shuttle Vectors Search the table ... or sort by the table headings. Click on the publication link to view all other plasmids from that article...Description Vector Type Selectable Marker PI Publication Back to Top Do you have suggestions for other...

...expressed from plasmids. These antibodies undergo application-specific validation and consistent quality control...and provide experimental data for recommended applications. Addgene values transparency and accessibility...Additionally, we have developed a variety of educational resources to help you choose and use antibodies...antibodies developed and validated for many research applications. Browse Antibodies Production Interested in ... storage techniques, and explain common applications. View Guide Need Some Help? Browse some of our...

...DNA. Fusing the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...binding. Editors carrying the delta-984-1090 ADAR2 truncation retain RNA editing capabilities but are small...systems. Mammalian ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible with? CRISPR...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

... Tools for Affinity Purification These AAV encode tools for affinity purification (which can be used for...tet-off transactivators and tools for affinity purification (TRAP). Viral... Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...

...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant ID...Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty Prime...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

...MoClo : Modular cloning for applications like recombinant protein purification and cell-free circuit design...distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases they cause....our Search page to look for specific genes or applications that are not listed here. Addgene Microbiology...fluorescent protein plasmid collection is organized by application and by color. External Resources European Saccharomyces...

...implementation letter DNA amplification Viral vector production Density centrifugation purification Addgene’s comprehensive...preps, which includes MTA facilitation, DNA amplification, and high-quality quality control measures such...order ships. Shipping time will depend on your location. Share Your Results Once you start getting results...high-quality viral vector preps at Addgene, including purification, titration, and quality control measures. We...

...Golden Gate TALEN kit. The GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation...pC-GoldyTALEN directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed...in vitro mRNA synthesis from the T7 promoter. Truncations were introduced to the N- and C-terminus of the...Golden Gate TALEN 2.0 48705 pTAL7a Boris Greber Application of TALEN technology in hPSCs pTAL7a and pTAL7b...expression in mammalian cells, (iv) an improved, truncated TALE backbone architecture as established by Miller...

...computational pipeline that enables accurate quantification and visualization of CRISPR-Cas9 outcomes, ...off-target sites. This algorithm allows for the quantification of both non-homologous end joining (NHEJ) and...number of potential off-targets, target's genomic location, and genome annotation. Available genomes are ...sequence, which can be an accession number, genomic location, pasted nucleotide sequence, or a sequence text...-EGFP PDF 2.3 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system...

... disruptions, missense mutations located in the MBD, and truncations prior to the NID are more severe ...even within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor...Line Mutation (DNA) Background Strain Purpose Publication PI Mecp2 NLucTom Knock-in of NLuc-tdTomato at...DNA) Mutation (protein) Sex Source of Material Publication PI N126I A377T N126I M Fibroblasts & iPSC (Link...

...generally introduced in the media. A new codon to be allocated to the new amino acid. Because there are no free...single plasmid, with multiple copies of the tRNA. Applications By making small changes in selected amino acids...tRNA. And the orthogonal tRNA has to bind to an unallocated codon. Therefore many controls must be used to...code expansion without buildup of prematurely truncated protein. Ryan Mehl 197656 BL21(DE3) ΔserC serC...gene replaced by tRNA variant inactivated by the truncation of the anticodon loop). Expresses archaeal MjTyrRS...genes replaced by tRNA variant inactivated by the truncation of the anticodon loop). Expresses archaeal MjTyrRS...

... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...

...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...

...defined by their location, their pathway dependencies are extremely important for classification and treatment...network for transitioning between anabolic and catabolic states. Ras Ras is a GTPase that is essential ... described in the initial Target Accelerator publications, focused on somatic variants found in lung adenocarcinoma...