Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Vector Database


Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: pCD33_Exon 1-7_plus introns_T

Source/Vendor: Petra van Bergeijk and Samuel A. Hasson
Analyze: Sequence
Promotor: CMV
Expression Level: High
Cloning Method: Restriction Enzyme
Size: 6353
5' Sequencing 1 Primer: CMV-FORWARD
5' Sequencing 1 Primer Sequence: 5'- CGCAAATGGGCGGTAGGCGTG 3'
3' Sequencing 1 Primer: BGHR
3' Sequencing 1 Primer Sequence: 5'- TAGAAGGCACAGTCGAGG -3'
Notes:
Expression vector derived from pcDNA3.1-Zeo for CD33 splicing analysis. This vector expresses human CD33 (Exon 1-7) cDNA with the native introns 1 and 2 within the sequence. The construct carries the rs12459419(T) allele.
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map

Loading...

Published Plasmid Map