Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Vector Database


Welcome to Vector Database!

Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.

This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.

This vector is NOT available from Addgene.

Plasmid: 7. pCD33_Exon1-7_plus introns_C_Extended pY

Source/Vendor: Petra van Bergeijk and Samuel A. Hasson
Analyze: Sequence
Promotor: CMV
Expression Level: High
Cloning Method: Restriction Enzyme
Size: 6362
5' Sequencing 1 Primer: CMV-FORWARD
5' Sequencing 1 Primer Sequence: 5'- CGCAAATGGGCGGTAGGCGTG 3'
3' Sequencing 1 Primer: BGHR
3' Sequencing 1 Primer Sequence: 5'- TAGAAGGCACAGTCGAGG -3'
Notes:
Expression vector derived from pcDNA3.1-Zeo for CD33 splicing analysis. This vector expresses human CD33 (Exon 1-7) cDNA with the native introns 1 and 2 within the sequence. The construct carries the rs12459419(C) allele and an extended polypyrimidine tract in intron 1.
Stable: Transient
Constitutive: Constitutive
Viral/Non-Viral: Nonviral

Generated Plasmid Map

Loading...

Published Plasmid Map