Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pcDNA3.1/Zeo(+)
| Source/Vendor: | Invitrogen |
| Alt Name: | pcDNA™3.1/Zeo(+) |
| Analyze: | Sequence |
| Plasmid Type: | Mammalian Expression |
| Promotor: | CMV |
| Expression Level: | High |
| Cloning Method: | Unknown |
| Size: | 5015 |
| 5' Sequencing 1 Primer: | T7 Fwd |
| 5' Sequencing 1 Primer Sequence: | 5'd[TAATACGACTCACTATAGGG]3' |
| Bacterial Resistance: | Ampicillin |
| Selectable Marker: | Zeocin |
| Notes: | Differs from other pcDNA3.1 in drug resistance; +/- refers to orientation of f1 ori.
Mammalian expression vector with the CMV promoter. The MCS is in the forward (+) orientation. |
| Catalog Number: | V86020 |
| Stable: | Transient |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |