Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pET-32 a,b,c(+)
| Source/Vendor: | EMD Biosciences |
| Alt Name: | pET32a, pET32b, pET32c |
| Analyze: | Sequence |
| Plasmid Type: | Bacterial Expression |
| Expression Level: | High |
| Cloning Method: | Unknown |
| Size: | 5900 |
| 5' Sequencing 1 Primer: | T7 Fwd |
| 5' Sequencing 1 Primer Sequence: | 5'd[TAATACGACTCACTATAGGG]3' |
| Tag 1: | thioredoxin (Nterm); His (internal and Cterm) |
| Bacterial Resistance: | Ampicillin |
| Notes: | Production of soluble, active target proteins; Nterm thrombin cleavage site; Nterm enterokinase cleavage site; a,b,c vary by MCS |
| Catalog Number: | 69015-3, 69016-3, 69017-3 |
| Stable: | Transient |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |