Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pIB-E Echo
| Source/Vendor: | Invitrogen |
| Analyze: | Sequence |
| Plasmid Type: | Other |
| Promotor: | OpIE2 |
| Cloning Method: | Unknown |
| Size: | 2500 |
| 5' Sequencing 1 Primer: | OpIE2 |
| 5' Sequencing 1 Primer Sequence: | 5'd[CGCAACGATCTGGTAAACAC]3' |
| Selectable Marker: | Blasticidin |
| Notes: | Stable expression of gene in insect cells. For use with Echo cloning system. |
| Catalog Number: | ET32001 |
| Stable: | Stable |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Nonviral |