Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pQCXIH
| Source/Vendor: | Clontech |
| Analyze: | Sequence |
| Plasmid Type: | Retroviral |
| Promotor: | CMV/MSV |
| Cloning Method: | Unknown |
| Size: | 7800 |
| 5' Sequencing 1 Primer: | QC |
| 5' Sequencing 1 Primer Sequence: | 5'd[ACGCCATCCACGCTGTTTTGACCT]3' |
| Tag 1: | IRES-Hygro |
| Bacterial Resistance: | Ampicillin |
| Selectable Marker: | Hygromycin |
| Notes: | Retroviral expression with IRES Hygro
Self-inactivating bicistronic retroviral vector for expression of a gene together with a hygromycin-resistance marker.
|
| Catalog Number: | 631516 |
| Stable: | Stable |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Retroviral |