Vector Database
Welcome to Vector Database!
Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. This is a free resource for the scientific community that is compiled by Addgene.
This page is informational only - this vector is NOT available from Addgene - please contact the manufacturer for further details.
This vector is NOT available from Addgene.
Plasmid: pRetro-LIB
| Source/Vendor: | Clontech |
| Analyze: | Sequence |
| Plasmid Type: | Retroviral |
| Promotor: | LTR |
| Cloning Method: | Unknown |
| Size: | 4900 |
| 5' Sequencing 1 Primer: | LIB |
| 5' Sequencing 1 Primer Sequence: | 5'd[AGCCCTCACTCCTTCTCTAG]3' |
| Bacterial Resistance: | Ampicillin |
| Notes: | Retroviral vector for delivery and expression of libraries or individual genes. |
| Catalog Number: | PT3627-5 |
| Stable: | Stable |
| Constitutive: | Constitutive |
| Viral/Non-Viral: | Retroviral |