Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry (PV2670)
(Plasmid #100061)


Item Catalog # Description Quantity Price (USD)
Plasmid 100061 Standard format: Plasmid sent in bacteria as agar stab 1 $65
AAV9 100061-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Modifications to backbone
    Addition of Ef1a promoter, Lox sites and a WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    ChR1-VChR1 Chimera
  • Alt name
    C1V1 (t/t)
  • Species
  • Insert Size (bp)
  • Mutation
    E122T and E162T
  • GenBank ID
  • Promoter EF1a
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Penn Vector Core PV2670

Information for AAV9 (Catalog # 100061-AAV9) ( Back to top )


Ready-to-use AAV9 particles produced from pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry (PV2670) (#100061). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry (PV2670) plasmid DNA.

EFIa-driven, Cre-dependent, C1V1 (t/t) fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry (PV2670) was a gift from Karl Deisseroth (Addgene plasmid # 100061 ; ; RRID:Addgene_100061)

    For viral preps, please replace (Addgene plasmid # 100061) in the above sentence with: (Addgene viral prep # 100061-AAV9)