This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

(Plasmid #35506)


Item Catalog # Description Quantity Price (USD)
Plasmid 35506 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5385
  • Modifications to backbone
    Addition of a CaMKIIa promoter and a WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    Chlamydomonas reinhardtii
  • Insert Size (bp)
  • Mutation
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGTCCTGCAGTATTGTGTAT
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-hChR2(E123A)-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 35506)
  • For your References section:

    Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Mattis J, Tye KM, Ferenczi EA, Ramakrishnan C, O'Shea DJ, Prakash R, Gunaydin LA, Hyun M, Fenno LE, Gradinaru V, Yizhar O, Deisseroth K. Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808. 10.1038/nmeth.1808 PubMed 22179551